Incidental Mutation 'R5410:9230019H11Rik'
ID426509
Institutional Source Beutler Lab
Gene Symbol 9230019H11Rik
Ensembl Gene ENSMUSG00000071434
Gene NameRIKEN cDNA 9230019H11 gene
Synonyms
MMRRC Submission 042979-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.349) question?
Stock #R5410 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location3119841-3129546 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to A at 3126473 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000095874
SMART Domains Protein: ENSMUSP00000093559
Gene: ENSMUSG00000071434

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
PDB:1KCG|C 57 207 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217333
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 40,681,064 M524V probably benign Het
Adamts20 T A 15: 94,281,957 N1788I possibly damaging Het
Arfgef3 T G 10: 18,611,237 I1350L probably damaging Het
Arhgap17 A G 7: 123,297,493 probably null Het
Ascl5 A T 1: 136,051,188 I129F probably damaging Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bpifb9a A T 2: 154,270,235 N564Y probably benign Het
Cdon G T 9: 35,470,035 D574Y probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Ces1e T A 8: 93,210,442 I334F possibly damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Cntn3 T A 6: 102,278,353 T195S probably benign Het
Csmd2 C A 4: 128,548,819 H3221Q probably benign Het
Cyp2c68 T C 19: 39,699,284 D423G possibly damaging Het
Dennd3 C T 15: 73,547,448 T696M probably benign Het
Ep300 T C 15: 81,648,854 M1704T unknown Het
Exoc2 A G 13: 30,864,856 F738S probably damaging Het
Fis1 A G 5: 136,965,566 E36G probably damaging Het
Galnt1 A G 18: 24,267,547 I237V probably benign Het
Gspt1 A T 16: 11,230,510 I416N probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hykk G A 9: 54,946,066 C224Y probably damaging Het
Ifi211 T C 1: 173,906,263 T111A probably benign Het
Il17rd T C 14: 27,095,911 Y186H probably damaging Het
Klhl29 G T 12: 5,091,366 N539K probably benign Het
Lmbr1l T C 15: 98,909,262 T213A probably damaging Het
Madd C T 2: 91,154,514 R1318Q probably damaging Het
Mecom C A 3: 29,997,721 A182S probably benign Het
Olfr1305 C T 2: 111,873,292 A188T probably damaging Het
Olfr20 C T 11: 73,353,806 P18S probably benign Het
Olfr272 C A 4: 52,910,991 A268S probably benign Het
Olfr67 A T 7: 103,787,374 V301E probably damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pdia5 A G 16: 35,453,536 V130A probably damaging Het
Phldb2 T A 16: 45,825,612 H202L possibly damaging Het
Ppig G A 2: 69,735,897 G136E probably null Het
Prr14l C A 5: 32,827,777 R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 Y714C probably damaging Het
Ptprr T C 10: 116,188,330 V182A possibly damaging Het
Rai14 A G 15: 10,574,938 Y645H probably damaging Het
Rasgrp3 T C 17: 75,497,047 I115T probably benign Het
Rc3h1 G T 1: 160,964,963 R990L possibly damaging Het
Rdh5 T A 10: 128,918,291 Q21L probably benign Het
Rfx8 A G 1: 39,710,156 probably null Het
Scap A G 9: 110,374,182 probably null Het
Shank1 T A 7: 44,351,822 S988R unknown Het
Slc16a14 T A 1: 84,907,424 I465F probably damaging Het
Slc41a2 A G 10: 83,281,368 probably null Het
Tab2 T C 10: 7,919,821 H225R possibly damaging Het
Tbx19 T A 1: 165,160,372 N64I probably damaging Het
Tmprss11f A T 5: 86,530,106 I268K probably damaging Het
Tox2 A G 2: 163,320,373 M388V probably benign Het
Trbv17 T C 6: 41,163,538 L109P probably damaging Het
Trim72 A G 7: 128,009,923 H299R probably damaging Het
Vmn1r63 C T 7: 5,803,190 V148I possibly damaging Het
Zfp938 A C 10: 82,225,258 H509Q possibly damaging Het
Zfyve16 A G 13: 92,521,231 V724A probably benign Het
Zscan10 T C 17: 23,610,421 F569L probably damaging Het
Other mutations in 9230019H11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:9230019H11Rik APN 10 3120231 unclassified noncoding transcript
IGL01018:9230019H11Rik APN 10 3120209 unclassified noncoding transcript
IGL01018:9230019H11Rik APN 10 3125031 unclassified noncoding transcript
IGL01018:9230019H11Rik APN 10 3125193 exon noncoding transcript
IGL02388:9230019H11Rik APN 10 3125050 unclassified noncoding transcript
IGL02560:9230019H11Rik APN 10 3125866 exon noncoding transcript
IGL03293:9230019H11Rik APN 10 3125699 exon noncoding transcript
R0357:9230019H11Rik UTSW 10 3120307 unclassified noncoding transcript
R0357:9230019H11Rik UTSW 10 3125788 exon noncoding transcript
R0582:9230019H11Rik UTSW 10 3125082 unclassified noncoding transcript
R0680:9230019H11Rik UTSW 10 3125133 exon noncoding transcript
R1116:9230019H11Rik UTSW 10 3120180 unclassified noncoding transcript
R1519:9230019H11Rik UTSW 10 3125230 exon noncoding transcript
R1717:9230019H11Rik UTSW 10 3125050 unclassified noncoding transcript
R2112:9230019H11Rik UTSW 10 3126459 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- CACGAGCATTTTGAGGTCAGG -3'
(R):5'- TGGGATTCCTGGAACTCACTC -3'

Sequencing Primer
(F):5'- CATTTTGAGGTCAGGGACATTCC -3'
(R):5'- GGATTCCTGGAACTCACTCACTCTTG -3'
Posted On2016-09-01