Incidental Mutation 'R5410:Tab2'
ID 426510
Institutional Source Beutler Lab
Gene Symbol Tab2
Ensembl Gene ENSMUSG00000015755
Gene Name TGF-beta activated kinase 1/MAP3K7 binding protein 2
Synonyms 1110030N06Rik, Map3k7ip2, A530078N03Rik, Tak1 binding protein 2
MMRRC Submission 042979-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 7781417-7831994 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 7795585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 225 (H225R)
Ref Sequence ENSEMBL: ENSMUSP00000122559 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000130322] [ENSMUST00000146444] [ENSMUST00000147938]
AlphaFold Q99K90
Predicted Effect possibly damaging
Transcript: ENSMUST00000130322
AA Change: H225R

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000122559
Gene: ENSMUSG00000015755
AA Change: H225R

DomainStartEndE-ValueType
low complexity region 212 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146444
AA Change: H299R

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000121266
Gene: ENSMUSG00000015755
AA Change: H299R

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
coiled coil region 532 619 N/A INTRINSIC
ZnF_RBZ 666 690 1.91e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147938
AA Change: H299R

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119515
Gene: ENSMUSG00000015755
AA Change: H299R

DomainStartEndE-ValueType
CUE 8 50 1.15e-10 SMART
low complexity region 286 311 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an activator of MAP3K7/TAK1, which is required for for the IL-1 induced activation of nuclear factor kappaB and MAPK8/JNK. This protein forms a kinase complex with TRAF6, MAP3K7 and TAB1, and it thus serves as an adaptor that links MAP3K7 and TRAF6. This protein, along with TAB1 and MAP3K7, also participates in the signal transduction induced by TNFSF11/RANKl through the activation of the receptor activator of NF-kappaB (TNFRSF11A/RANK), which may regulate the development and function of osteoclasts. Studies of the related mouse protein indicate that it functions to protect against liver damage caused by chemical stressors. Mutations in this gene cause congenital heart defects, multiple types, 2 (CHTD2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Embryos homozygous for a knock-out allele are viable up to E9.5. Embryos homozygous for a different knock-out allele are normal and viable up to E11.5 but become pale and anemic, exhibit liver hemorrhage and increased apoptosis of hepatoblasts, and die by E12.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 41,134,103 (GRCm39) M524V probably benign Het
Adamts20 T A 15: 94,179,838 (GRCm39) N1788I possibly damaging Het
Arfgef3 T G 10: 18,486,985 (GRCm39) I1350L probably damaging Het
Arhgap17 A G 7: 122,896,716 (GRCm39) probably null Het
Ascl5 A T 1: 135,978,926 (GRCm39) I129F probably damaging Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bpifb9a A T 2: 154,112,155 (GRCm39) N564Y probably benign Het
Cdon G T 9: 35,381,331 (GRCm39) D574Y probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Ces1e T A 8: 93,937,070 (GRCm39) I334F possibly damaging Het
Clip2 G A 5: 134,551,645 (GRCm39) T159M possibly damaging Het
Cntn3 T A 6: 102,255,314 (GRCm39) T195S probably benign Het
Csmd2 C A 4: 128,442,612 (GRCm39) H3221Q probably benign Het
Cyp2c68 T C 19: 39,687,728 (GRCm39) D423G possibly damaging Het
Dennd3 C T 15: 73,419,297 (GRCm39) T696M probably benign Het
Ep300 T C 15: 81,533,055 (GRCm39) M1704T unknown Het
Exoc2 A G 13: 31,048,839 (GRCm39) F738S probably damaging Het
Fis1 A G 5: 136,994,420 (GRCm39) E36G probably damaging Het
Galnt1 A G 18: 24,400,604 (GRCm39) I237V probably benign Het
Gspt1 A T 16: 11,048,374 (GRCm39) I416N probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hykk G A 9: 54,853,350 (GRCm39) C224Y probably damaging Het
Ifi211 T C 1: 173,733,829 (GRCm39) T111A probably benign Het
Il17rd T C 14: 26,817,868 (GRCm39) Y186H probably damaging Het
Klhl29 G T 12: 5,141,366 (GRCm39) N539K probably benign Het
Lmbr1l T C 15: 98,807,143 (GRCm39) T213A probably damaging Het
Madd C T 2: 90,984,859 (GRCm39) R1318Q probably damaging Het
Mecom C A 3: 30,051,870 (GRCm39) A182S probably benign Het
Or13c25 C A 4: 52,910,991 (GRCm39) A268S probably benign Het
Or1e1 C T 11: 73,244,632 (GRCm39) P18S probably benign Het
Or4f56 C T 2: 111,703,637 (GRCm39) A188T probably damaging Het
Or52z1 A T 7: 103,436,581 (GRCm39) V301E probably damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
Pdia5 A G 16: 35,273,906 (GRCm39) V130A probably damaging Het
Phldb2 T A 16: 45,645,975 (GRCm39) H202L possibly damaging Het
Ppig G A 2: 69,566,241 (GRCm39) G136E probably null Het
Prr14l C A 5: 32,985,121 (GRCm39) R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 (GRCm39) Y714C probably damaging Het
Ptprr T C 10: 116,024,235 (GRCm39) V182A possibly damaging Het
Rai14 A G 15: 10,575,024 (GRCm39) Y645H probably damaging Het
Rasgrp3 T C 17: 75,804,042 (GRCm39) I115T probably benign Het
Rc3h1 G T 1: 160,792,533 (GRCm39) R990L possibly damaging Het
Rdh5 T A 10: 128,754,160 (GRCm39) Q21L probably benign Het
Rfx8 A G 1: 39,749,316 (GRCm39) probably null Het
Scap A G 9: 110,203,250 (GRCm39) probably null Het
Shank1 T A 7: 44,001,246 (GRCm39) S988R unknown Het
Slc16a14 T A 1: 84,885,145 (GRCm39) I465F probably damaging Het
Slc41a2 A G 10: 83,117,232 (GRCm39) probably null Het
Tbx19 T A 1: 164,987,941 (GRCm39) N64I probably damaging Het
Tmprss11f A T 5: 86,677,965 (GRCm39) I268K probably damaging Het
Tox2 A G 2: 163,162,293 (GRCm39) M388V probably benign Het
Trbv17 T C 6: 41,140,472 (GRCm39) L109P probably damaging Het
Trim72 A G 7: 127,609,095 (GRCm39) H299R probably damaging Het
Ulbp3 G A 10: 3,076,473 (GRCm39) noncoding transcript Het
Vmn1r63 C T 7: 5,806,189 (GRCm39) V148I possibly damaging Het
Zfp938 A C 10: 82,061,092 (GRCm39) H509Q possibly damaging Het
Zfyve16 A G 13: 92,657,739 (GRCm39) V724A probably benign Het
Zscan10 T C 17: 23,829,395 (GRCm39) F569L probably damaging Het
Other mutations in Tab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Tab2 APN 10 7,785,837 (GRCm39) missense probably benign 0.21
IGL01316:Tab2 APN 10 7,800,468 (GRCm39) missense probably damaging 1.00
IGL01902:Tab2 APN 10 7,795,756 (GRCm39) missense probably benign 0.12
IGL03338:Tab2 APN 10 7,795,039 (GRCm39) missense probably damaging 1.00
Cosmo UTSW 10 7,800,483 (GRCm39) missense probably damaging 1.00
Cosmo-2 UTSW 10 7,783,245 (GRCm39) missense probably damaging 1.00
R0068:Tab2 UTSW 10 7,795,441 (GRCm39) missense probably damaging 1.00
R0068:Tab2 UTSW 10 7,795,441 (GRCm39) missense probably damaging 1.00
R0271:Tab2 UTSW 10 7,794,922 (GRCm39) missense probably benign
R0458:Tab2 UTSW 10 7,795,319 (GRCm39) missense probably damaging 1.00
R0608:Tab2 UTSW 10 7,795,883 (GRCm39) missense probably damaging 0.99
R0632:Tab2 UTSW 10 7,795,565 (GRCm39) missense probably benign 0.07
R0744:Tab2 UTSW 10 7,783,345 (GRCm39) unclassified probably benign
R1162:Tab2 UTSW 10 7,800,483 (GRCm39) missense probably damaging 1.00
R1424:Tab2 UTSW 10 7,795,812 (GRCm39) missense possibly damaging 0.86
R1954:Tab2 UTSW 10 7,795,094 (GRCm39) missense probably damaging 1.00
R2516:Tab2 UTSW 10 7,783,245 (GRCm39) missense probably damaging 1.00
R2518:Tab2 UTSW 10 7,783,245 (GRCm39) missense probably damaging 1.00
R2520:Tab2 UTSW 10 7,783,245 (GRCm39) missense probably damaging 1.00
R3418:Tab2 UTSW 10 7,783,245 (GRCm39) missense probably damaging 1.00
R4081:Tab2 UTSW 10 7,795,595 (GRCm39) missense probably damaging 1.00
R4177:Tab2 UTSW 10 7,795,123 (GRCm39) missense probably damaging 1.00
R4178:Tab2 UTSW 10 7,795,123 (GRCm39) missense probably damaging 1.00
R5681:Tab2 UTSW 10 7,795,837 (GRCm39) missense probably damaging 1.00
R5683:Tab2 UTSW 10 7,794,876 (GRCm39) critical splice donor site probably null
R6857:Tab2 UTSW 10 7,796,177 (GRCm39) missense possibly damaging 0.50
R7424:Tab2 UTSW 10 7,783,247 (GRCm39) missense probably damaging 1.00
R7692:Tab2 UTSW 10 7,786,869 (GRCm39) missense probably damaging 1.00
R7790:Tab2 UTSW 10 7,796,188 (GRCm39) missense probably damaging 1.00
R7792:Tab2 UTSW 10 7,794,897 (GRCm39) missense possibly damaging 0.50
R8897:Tab2 UTSW 10 7,786,897 (GRCm39) missense probably damaging 1.00
R9014:Tab2 UTSW 10 7,794,920 (GRCm39) missense probably damaging 1.00
R9482:Tab2 UTSW 10 7,795,124 (GRCm39) missense probably damaging 1.00
R9616:Tab2 UTSW 10 7,795,005 (GRCm39) missense possibly damaging 0.88
R9733:Tab2 UTSW 10 7,795,214 (GRCm39) missense possibly damaging 0.69
Z1088:Tab2 UTSW 10 7,796,030 (GRCm39) missense possibly damaging 0.88
Z1177:Tab2 UTSW 10 7,794,943 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- GTTGACCAATGAGGAAGTGCTG -3'
(R):5'- ACTCCTAGTGGTACAGCTCG -3'

Sequencing Primer
(F):5'- CTGGCAGTTCGAGGTCCAGAAG -3'
(R):5'- CAACAACATTCTGGCTGGGTGTC -3'
Posted On 2016-09-01