Mutagenetix > Incidental Mutation

Incidental Mutation 'R5410:Arfgef3'

426511

Institutional Source

Beutler Lab

Gene Symbol

Arfgef3

Ensembl Gene

ENSMUSG00000019852

Gene Name

ARFGEF family member 3

Synonyms

B930094H20Rik, D10Bwg1379e, BIG3

MMRRC Submission

042979-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R5410 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

18581839-18743949 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 18611237 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Leucine at position 1350 (I1350L)

Ref Sequence

ENSEMBL: ENSMUSP00000149210 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019999] [ENSMUST00000215836]

AlphaFold

Q3UGY8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000019999
AA Change: I1350L

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000019999
Gene: ENSMUSG00000019852
AA Change: I1350L

Domain	Start	End	E-Value	Type
Pfam:DCB	1	170	7.1e-15	PFAM
low complexity region	236	245	N/A	INTRINSIC
low complexity region	276	295	N/A	INTRINSIC
low complexity region	452	462	N/A	INTRINSIC
Sec7	582	794	6e-54	SMART
Blast:Sec7	798	873	3e-20	BLAST
low complexity region	927	940	N/A	INTRINSIC
Pfam:DUF1981	1237	1312	1.9e-14	PFAM
low complexity region	1641	1652	N/A	INTRINSIC
low complexity region	1710	1723	N/A	INTRINSIC
low complexity region	1838	1856	N/A	INTRINSIC
low complexity region	2088	2099	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000215836
AA Change: I1350L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased insulin granule biogenesis and insulin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,126,473		noncoding transcript	Het
Adam24	A	G	8: 40,681,064	M524V	probably benign	Het
Adamts20	T	A	15: 94,281,957	N1788I	possibly damaging	Het
Arhgap17	A	G	7: 123,297,493		probably null	Het
Ascl5	A	T	1: 136,051,188	I129F	probably damaging	Het
AU040320	A	T	4: 126,823,716	H362L	possibly damaging	Het
Bpifb9a	A	T	2: 154,270,235	N564Y	probably benign	Het
Cdon	G	T	9: 35,470,035	D574Y	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Ces1e	T	A	8: 93,210,442	I334F	possibly damaging	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Cntn3	T	A	6: 102,278,353	T195S	probably benign	Het
Csmd2	C	A	4: 128,548,819	H3221Q	probably benign	Het
Cyp2c68	T	C	19: 39,699,284	D423G	possibly damaging	Het
Dennd3	C	T	15: 73,547,448	T696M	probably benign	Het
Ep300	T	C	15: 81,648,854	M1704T	unknown	Het
Exoc2	A	G	13: 30,864,856	F738S	probably damaging	Het
Fis1	A	G	5: 136,965,566	E36G	probably damaging	Het
Galnt1	A	G	18: 24,267,547	I237V	probably benign	Het
Gspt1	A	T	16: 11,230,510	I416N	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hykk	G	A	9: 54,946,066	C224Y	probably damaging	Het
Ifi211	T	C	1: 173,906,263	T111A	probably benign	Het
Il17rd	T	C	14: 27,095,911	Y186H	probably damaging	Het
Klhl29	G	T	12: 5,091,366	N539K	probably benign	Het
Lmbr1l	T	C	15: 98,909,262	T213A	probably damaging	Het
Madd	C	T	2: 91,154,514	R1318Q	probably damaging	Het
Mecom	C	A	3: 29,997,721	A182S	probably benign	Het
Olfr1305	C	T	2: 111,873,292	A188T	probably damaging	Het
Olfr20	C	T	11: 73,353,806	P18S	probably benign	Het
Olfr272	C	A	4: 52,910,991	A268S	probably benign	Het
Olfr67	A	T	7: 103,787,374	V301E	probably damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
Pdia5	A	G	16: 35,453,536	V130A	probably damaging	Het
Phldb2	T	A	16: 45,825,612	H202L	possibly damaging	Het
Ppig	G	A	2: 69,735,897	G136E	probably null	Het
Prr14l	C	A	5: 32,827,777	R1458L	probably damaging	Het
Ptpn3	T	C	4: 57,205,019	Y714C	probably damaging	Het
Ptprr	T	C	10: 116,188,330	V182A	possibly damaging	Het
Rai14	A	G	15: 10,574,938	Y645H	probably damaging	Het
Rasgrp3	T	C	17: 75,497,047	I115T	probably benign	Het
Rc3h1	G	T	1: 160,964,963	R990L	possibly damaging	Het
Rdh5	T	A	10: 128,918,291	Q21L	probably benign	Het
Rfx8	A	G	1: 39,710,156		probably null	Het
Scap	A	G	9: 110,374,182		probably null	Het
Shank1	T	A	7: 44,351,822	S988R	unknown	Het
Slc16a14	T	A	1: 84,907,424	I465F	probably damaging	Het
Slc41a2	A	G	10: 83,281,368		probably null	Het
Tab2	T	C	10: 7,919,821	H225R	possibly damaging	Het
Tbx19	T	A	1: 165,160,372	N64I	probably damaging	Het
Tmprss11f	A	T	5: 86,530,106	I268K	probably damaging	Het
Tox2	A	G	2: 163,320,373	M388V	probably benign	Het
Trbv17	T	C	6: 41,163,538	L109P	probably damaging	Het
Trim72	A	G	7: 128,009,923	H299R	probably damaging	Het
Vmn1r63	C	T	7: 5,803,190	V148I	possibly damaging	Het
Zfp938	A	C	10: 82,225,258	H509Q	possibly damaging	Het
Zfyve16	A	G	13: 92,521,231	V724A	probably benign	Het
Zscan10	T	C	17: 23,610,421	F569L	probably damaging	Het

Other mutations in Arfgef3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00769:Arfgef3	APN	10	18660604	missense	probably benign	0.03
IGL00835:Arfgef3	APN	10	18661358	missense	probably benign
IGL00961:Arfgef3	APN	10	18611237	missense	probably damaging	1.00
IGL01400:Arfgef3	APN	10	18652706	missense	probably damaging	1.00
IGL01501:Arfgef3	APN	10	18600560	missense	possibly damaging	0.93
IGL01595:Arfgef3	APN	10	18594912	missense	possibly damaging	0.93
IGL01695:Arfgef3	APN	10	18603419	missense	probably benign	0.00
IGL01774:Arfgef3	APN	10	18743615	missense	possibly damaging	0.94
IGL02348:Arfgef3	APN	10	18591347	missense	probably benign	0.04
IGL02371:Arfgef3	APN	10	18646539	missense	probably benign
IGL02400:Arfgef3	APN	10	18646257	missense	probably damaging	1.00
IGL02630:Arfgef3	APN	10	18661392	splice site	probably benign
IGL02815:Arfgef3	APN	10	18652551	missense	probably damaging	1.00
IGL03178:Arfgef3	APN	10	18613225	missense	probably damaging	1.00
IGL03182:Arfgef3	APN	10	18600544	missense	probably damaging	1.00
IGL03267:Arfgef3	APN	10	18591882	missense	probably damaging	1.00
IGL03294:Arfgef3	APN	10	18664912	missense	probably damaging	0.97
IGL03410:Arfgef3	APN	10	18600490	missense	probably damaging	1.00
Bow-wow	UTSW	10	18646730	nonsense	probably null
R0098:Arfgef3	UTSW	10	18589642	missense	probably damaging	1.00
R0098:Arfgef3	UTSW	10	18589642	missense	probably damaging	1.00
R0141:Arfgef3	UTSW	10	18597407	missense	probably damaging	1.00
R0164:Arfgef3	UTSW	10	18647915	missense	possibly damaging	0.77
R0164:Arfgef3	UTSW	10	18647915	missense	possibly damaging	0.77
R0241:Arfgef3	UTSW	10	18599214	missense	probably damaging	1.00
R0334:Arfgef3	UTSW	10	18592281	missense	probably damaging	0.98
R0352:Arfgef3	UTSW	10	18661387	missense	probably benign	0.17
R0415:Arfgef3	UTSW	10	18613127	splice site	probably benign
R0417:Arfgef3	UTSW	10	18603511	missense	probably damaging	1.00
R0442:Arfgef3	UTSW	10	18677815	splice site	probably benign
R0507:Arfgef3	UTSW	10	18591621	missense	probably damaging	1.00
R0573:Arfgef3	UTSW	10	18599288	missense	probably damaging	1.00
R0582:Arfgef3	UTSW	10	18611290	missense	probably damaging	1.00
R0609:Arfgef3	UTSW	10	18597431	missense	probably benign	0.31
R0826:Arfgef3	UTSW	10	18589666	missense	probably damaging	0.98
R0919:Arfgef3	UTSW	10	18589735	missense	possibly damaging	0.89
R0980:Arfgef3	UTSW	10	18592118	missense	possibly damaging	0.82
R1027:Arfgef3	UTSW	10	18591375	missense	probably benign	0.02
R1140:Arfgef3	UTSW	10	18597348	missense	possibly damaging	0.77
R1491:Arfgef3	UTSW	10	18646554	missense	probably damaging	1.00
R1493:Arfgef3	UTSW	10	18630879	missense	probably damaging	0.96
R1529:Arfgef3	UTSW	10	18613222	nonsense	probably null
R1564:Arfgef3	UTSW	10	18591704	missense	probably damaging	1.00
R1654:Arfgef3	UTSW	10	18625148	missense	probably null	0.15
R1868:Arfgef3	UTSW	10	18661387	missense	probably benign	0.17
R1876:Arfgef3	UTSW	10	18597356	missense	probably damaging	1.00
R1908:Arfgef3	UTSW	10	18652763	missense	possibly damaging	0.80
R2211:Arfgef3	UTSW	10	18592245	missense	possibly damaging	0.54
R2316:Arfgef3	UTSW	10	18616953	missense	probably benign	0.19
R2393:Arfgef3	UTSW	10	18597787	missense	possibly damaging	0.88
R2407:Arfgef3	UTSW	10	18677866	missense	possibly damaging	0.63
R3076:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R3077:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R3963:Arfgef3	UTSW	10	18592277	missense	probably damaging	1.00
R4201:Arfgef3	UTSW	10	18619782	missense	probably benign	0.01
R4241:Arfgef3	UTSW	10	18625164	missense	probably damaging	1.00
R4244:Arfgef3	UTSW	10	18630420	missense	probably damaging	1.00
R4395:Arfgef3	UTSW	10	18597709	missense	probably damaging	1.00
R4455:Arfgef3	UTSW	10	18607675	missense	probably benign	0.18
R4480:Arfgef3	UTSW	10	18600600	missense	probably damaging	1.00
R4499:Arfgef3	UTSW	10	18608343	missense	possibly damaging	0.95
R4589:Arfgef3	UTSW	10	18646199	missense	probably damaging	1.00
R4635:Arfgef3	UTSW	10	18634855	missense	probably damaging	1.00
R4776:Arfgef3	UTSW	10	18654247	missense	probably benign
R4801:Arfgef3	UTSW	10	18591906	missense	probably benign	0.00
R4802:Arfgef3	UTSW	10	18591906	missense	probably benign	0.00
R4807:Arfgef3	UTSW	10	18646637	missense	probably benign
R4828:Arfgef3	UTSW	10	18652693	missense	probably damaging	0.99
R4861:Arfgef3	UTSW	10	18607731	missense	probably benign	0.01
R4861:Arfgef3	UTSW	10	18607731	missense	probably benign	0.01
R4917:Arfgef3	UTSW	10	18616890	missense	probably damaging	0.99
R4918:Arfgef3	UTSW	10	18616890	missense	probably damaging	0.99
R4922:Arfgef3	UTSW	10	18592186	missense	probably damaging	0.97
R4929:Arfgef3	UTSW	10	18630851	missense	probably benign	0.00
R4937:Arfgef3	UTSW	10	18589706	missense	probably damaging	0.98
R5290:Arfgef3	UTSW	10	18600460	missense	probably damaging	1.00
R5807:Arfgef3	UTSW	10	18647798	splice site	probably null
R5832:Arfgef3	UTSW	10	18630420	missense	probably damaging	1.00
R5887:Arfgef3	UTSW	10	18607665	nonsense	probably null
R6272:Arfgef3	UTSW	10	18646963	missense	probably benign	0.00
R6302:Arfgef3	UTSW	10	18652841	missense	probably damaging	0.97
R6397:Arfgef3	UTSW	10	18607665	nonsense	probably null
R6495:Arfgef3	UTSW	10	18611202	critical splice donor site	probably null
R6707:Arfgef3	UTSW	10	18621155	missense	probably benign	0.11
R6814:Arfgef3	UTSW	10	18595019	missense	probably damaging	1.00
R6830:Arfgef3	UTSW	10	18664889	critical splice donor site	probably null
R6870:Arfgef3	UTSW	10	18646730	nonsense	probably null
R6941:Arfgef3	UTSW	10	18625455	missense	possibly damaging	0.66
R7094:Arfgef3	UTSW	10	18646439	missense	probably damaging	1.00
R7179:Arfgef3	UTSW	10	18599267	missense	probably damaging	1.00
R7204:Arfgef3	UTSW	10	18646462	missense	probably damaging	1.00
R7247:Arfgef3	UTSW	10	18625391	missense	probably benign	0.00
R7249:Arfgef3	UTSW	10	18630835	missense	possibly damaging	0.62
R7318:Arfgef3	UTSW	10	18630463	missense	possibly damaging	0.89
R7391:Arfgef3	UTSW	10	18646259	missense	probably benign	0.05
R7527:Arfgef3	UTSW	10	18646629	missense	probably benign
R7618:Arfgef3	UTSW	10	18646281	missense	probably damaging	1.00
R7779:Arfgef3	UTSW	10	18595023	missense	probably damaging	0.99
R7851:Arfgef3	UTSW	10	18592286	missense	probably damaging	1.00
R8112:Arfgef3	UTSW	10	18652631	missense	possibly damaging	0.96
R8133:Arfgef3	UTSW	10	18611203	critical splice donor site	probably null
R8242:Arfgef3	UTSW	10	18630076	missense	probably benign	0.25
R8369:Arfgef3	UTSW	10	18589729	missense	probably benign	0.34
R8396:Arfgef3	UTSW	10	18652532	critical splice donor site	probably null
R8553:Arfgef3	UTSW	10	18603530	missense	probably damaging	0.99
R8798:Arfgef3	UTSW	10	18647051	missense	probably damaging	1.00
R8821:Arfgef3	UTSW	10	18652743	missense	possibly damaging	0.95
R8831:Arfgef3	UTSW	10	18652743	missense	possibly damaging	0.95
R8918:Arfgef3	UTSW	10	18635705	missense	probably benign	0.01
R8929:Arfgef3	UTSW	10	18603455	missense	probably damaging	1.00
R9001:Arfgef3	UTSW	10	18646728	missense	probably benign	0.32
R9077:Arfgef3	UTSW	10	18625151	missense	possibly damaging	0.81
R9258:Arfgef3	UTSW	10	18589639	missense	probably damaging	1.00
R9267:Arfgef3	UTSW	10	18599280	missense	probably damaging	1.00
R9358:Arfgef3	UTSW	10	18616880	missense	probably damaging	1.00
R9388:Arfgef3	UTSW	10	18630129	missense	probably benign	0.35
R9389:Arfgef3	UTSW	10	18603523	missense	probably damaging	1.00
R9563:Arfgef3	UTSW	10	18646527	missense	probably damaging	1.00
R9713:Arfgef3	UTSW	10	18652808	missense	probably damaging	1.00
X0026:Arfgef3	UTSW	10	18652626	missense	probably damaging	1.00
Z1176:Arfgef3	UTSW	10	18591437	missense	probably damaging	1.00
Z1176:Arfgef3	UTSW	10	18608358	missense	probably damaging	0.97
Z1176:Arfgef3	UTSW	10	18634852	missense	probably benign	0.26
Z1177:Arfgef3	UTSW	10	18607776	missense	probably damaging	1.00
Z1177:Arfgef3	UTSW	10	18627628	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AATTTGTGGTTAACCCTCCTGC -3'
(R):5'- AACTCTTTGGGAGGTACTGAGAG -3'

Sequencing Primer
(F):5'- ATATCTTGTTAGACCAAGTCTCACC -3'
(R):5'- GTACTGAGAGTATTAGCACCCTG -3'

Posted On

2016-09-01