Incidental Mutation 'R5410:Rdh5'
ID 426516
Institutional Source Beutler Lab
Gene Symbol Rdh5
Ensembl Gene ENSMUSG00000025350
Gene Name retinol dehydrogenase 5
Synonyms cRDH
MMRRC Submission 042979-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.417) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 128749457-128755906 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 128754160 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 21 (Q21L)
Ref Sequence ENSEMBL: ENSMUSP00000123183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026405] [ENSMUST00000026406] [ENSMUST00000131271] [ENSMUST00000135161] [ENSMUST00000137747] [ENSMUST00000145616] [ENSMUST00000149961] [ENSMUST00000153731]
AlphaFold O55240
Predicted Effect probably benign
Transcript: ENSMUST00000026405
SMART Domains Protein: ENSMUSP00000026405
Gene: ENSMUSG00000090247

DomainStartEndE-ValueType
Pfam:GCN5L1 5 125 3.1e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000026406
AA Change: Q91L

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000026406
Gene: ENSMUSG00000025350
AA Change: Q91L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:adh_short 29 194 3.6e-23 PFAM
Pfam:adh_short_C2 35 230 6.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131271
SMART Domains Protein: ENSMUSP00000114321
Gene: ENSMUSG00000090247

DomainStartEndE-ValueType
Pfam:GCN5L1 4 121 1.7e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135161
SMART Domains Protein: ENSMUSP00000115182
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
transmembrane domain 59 78 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137747
SMART Domains Protein: ENSMUSP00000116558
Gene: ENSMUSG00000025350

DomainStartEndE-ValueType
PDB:2JAP|D 1 80 6e-11 PDB
SCOP:d1hu4a_ 1 151 1e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139217
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141320
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143628
Predicted Effect probably benign
Transcript: ENSMUST00000145616
AA Change: Q91L

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123358
Gene: ENSMUSG00000025350
AA Change: Q91L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:adh_short 29 175 1.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149961
AA Change: Q21L

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000123183
Gene: ENSMUSG00000025350
AA Change: Q21L

DomainStartEndE-ValueType
Pfam:adh_short 2 124 4e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153935
Predicted Effect probably benign
Transcript: ENSMUST00000153731
SMART Domains Protein: ENSMUSP00000117408
Gene: ENSMUSG00000090247

DomainStartEndE-ValueType
Pfam:GCN5L1 5 92 1.6e-38 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme belonging to the short-chain dehydrogenases/reductases (SDR) family. This retinol dehydrogenase functions to catalyze the final step in the biosynthesis of 11-cis retinaldehyde, which is the universal chromophore of visual pigments. Mutations in this gene cause autosomal recessive fundus albipunctatus, a rare form of night blindness that is characterized by a delay in the regeneration of cone and rod photopigments. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream BLOC1S1 (biogenesis of lysosomal organelles complex-1, subunit 1) gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted null mutations exhibit an impaired dark adaptation and at high bleaching levels, a large increase in 11-cis-retinyl ester concentration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 41,134,103 (GRCm39) M524V probably benign Het
Adamts20 T A 15: 94,179,838 (GRCm39) N1788I possibly damaging Het
Arfgef3 T G 10: 18,486,985 (GRCm39) I1350L probably damaging Het
Arhgap17 A G 7: 122,896,716 (GRCm39) probably null Het
Ascl5 A T 1: 135,978,926 (GRCm39) I129F probably damaging Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bpifb9a A T 2: 154,112,155 (GRCm39) N564Y probably benign Het
Cdon G T 9: 35,381,331 (GRCm39) D574Y probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Ces1e T A 8: 93,937,070 (GRCm39) I334F possibly damaging Het
Clip2 G A 5: 134,551,645 (GRCm39) T159M possibly damaging Het
Cntn3 T A 6: 102,255,314 (GRCm39) T195S probably benign Het
Csmd2 C A 4: 128,442,612 (GRCm39) H3221Q probably benign Het
Cyp2c68 T C 19: 39,687,728 (GRCm39) D423G possibly damaging Het
Dennd3 C T 15: 73,419,297 (GRCm39) T696M probably benign Het
Ep300 T C 15: 81,533,055 (GRCm39) M1704T unknown Het
Exoc2 A G 13: 31,048,839 (GRCm39) F738S probably damaging Het
Fis1 A G 5: 136,994,420 (GRCm39) E36G probably damaging Het
Galnt1 A G 18: 24,400,604 (GRCm39) I237V probably benign Het
Gspt1 A T 16: 11,048,374 (GRCm39) I416N probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hykk G A 9: 54,853,350 (GRCm39) C224Y probably damaging Het
Ifi211 T C 1: 173,733,829 (GRCm39) T111A probably benign Het
Il17rd T C 14: 26,817,868 (GRCm39) Y186H probably damaging Het
Klhl29 G T 12: 5,141,366 (GRCm39) N539K probably benign Het
Lmbr1l T C 15: 98,807,143 (GRCm39) T213A probably damaging Het
Madd C T 2: 90,984,859 (GRCm39) R1318Q probably damaging Het
Mecom C A 3: 30,051,870 (GRCm39) A182S probably benign Het
Or13c25 C A 4: 52,910,991 (GRCm39) A268S probably benign Het
Or1e1 C T 11: 73,244,632 (GRCm39) P18S probably benign Het
Or4f56 C T 2: 111,703,637 (GRCm39) A188T probably damaging Het
Or52z1 A T 7: 103,436,581 (GRCm39) V301E probably damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
Pdia5 A G 16: 35,273,906 (GRCm39) V130A probably damaging Het
Phldb2 T A 16: 45,645,975 (GRCm39) H202L possibly damaging Het
Ppig G A 2: 69,566,241 (GRCm39) G136E probably null Het
Prr14l C A 5: 32,985,121 (GRCm39) R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 (GRCm39) Y714C probably damaging Het
Ptprr T C 10: 116,024,235 (GRCm39) V182A possibly damaging Het
Rai14 A G 15: 10,575,024 (GRCm39) Y645H probably damaging Het
Rasgrp3 T C 17: 75,804,042 (GRCm39) I115T probably benign Het
Rc3h1 G T 1: 160,792,533 (GRCm39) R990L possibly damaging Het
Rfx8 A G 1: 39,749,316 (GRCm39) probably null Het
Scap A G 9: 110,203,250 (GRCm39) probably null Het
Shank1 T A 7: 44,001,246 (GRCm39) S988R unknown Het
Slc16a14 T A 1: 84,885,145 (GRCm39) I465F probably damaging Het
Slc41a2 A G 10: 83,117,232 (GRCm39) probably null Het
Tab2 T C 10: 7,795,585 (GRCm39) H225R possibly damaging Het
Tbx19 T A 1: 164,987,941 (GRCm39) N64I probably damaging Het
Tmprss11f A T 5: 86,677,965 (GRCm39) I268K probably damaging Het
Tox2 A G 2: 163,162,293 (GRCm39) M388V probably benign Het
Trbv17 T C 6: 41,140,472 (GRCm39) L109P probably damaging Het
Trim72 A G 7: 127,609,095 (GRCm39) H299R probably damaging Het
Ulbp3 G A 10: 3,076,473 (GRCm39) noncoding transcript Het
Vmn1r63 C T 7: 5,806,189 (GRCm39) V148I possibly damaging Het
Zfp938 A C 10: 82,061,092 (GRCm39) H509Q possibly damaging Het
Zfyve16 A G 13: 92,657,739 (GRCm39) V724A probably benign Het
Zscan10 T C 17: 23,829,395 (GRCm39) F569L probably damaging Het
Other mutations in Rdh5
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4750:Rdh5 UTSW 10 128,754,235 (GRCm39) missense possibly damaging 0.92
R4965:Rdh5 UTSW 10 128,749,653 (GRCm39) missense probably damaging 1.00
R5893:Rdh5 UTSW 10 128,750,090 (GRCm39) splice site probably null
R5949:Rdh5 UTSW 10 128,754,136 (GRCm39) missense probably benign
R6541:Rdh5 UTSW 10 128,753,977 (GRCm39) missense possibly damaging 0.82
R7159:Rdh5 UTSW 10 128,754,184 (GRCm39) missense possibly damaging 0.86
R8171:Rdh5 UTSW 10 128,753,969 (GRCm39) missense probably benign 0.00
R8460:Rdh5 UTSW 10 128,754,136 (GRCm39) missense probably benign
R9405:Rdh5 UTSW 10 128,753,937 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCCAGCGTTATTCACCAGAC -3'
(R):5'- TGCTGTGGTTGCTCAGAGAC -3'

Sequencing Primer
(F):5'- CCAGACCAAAAAGTCCTGTGGG -3'
(R):5'- TTGCTCAGAGACCGGCAGAG -3'
Posted On 2016-09-01