Mutagenetix > Incidental Mutation

Incidental Mutation 'R5410:Exoc2'

426520

Institutional Source

Beutler Lab

Gene Symbol

Exoc2

Ensembl Gene

ENSMUSG00000021357

Gene Name

exocyst complex component 2

Synonyms

2410030I24Rik, Sec5l1, Sec5

MMRRC Submission

042979-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.954) question?

Stock #

R5410 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

30813919-30974093 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 30864856 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 738 (F738S)

Ref Sequence

ENSEMBL: ENSMUSP00000100010 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021785] [ENSMUST00000102946]

AlphaFold

Q9D4H1

Predicted Effect

probably damaging
Transcript: ENSMUST00000021785
AA Change: F738S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000021785
Gene: ENSMUSG00000021357
AA Change: F738S

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	3.2e-10	PFAM
Pfam:Sec5	198	377	3.6e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000102946
AA Change: F738S

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000100010
Gene: ENSMUSG00000021357
AA Change: F738S

Domain	Start	End	E-Value	Type
Pfam:TIG	8	92	2.5e-10	PFAM
Pfam:Sec5	198	377	7.5e-59	PFAM
low complexity region	572	585	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the exocyst complex, a multi-protein complex essential for the polarized targeting of exocytic vesicles to specific docking sites on the plasma membrane. Though best characterized in yeast, the component proteins and the functions of the exocyst complex have been demonstrated to be highly conserved in higher eukaryotes. At least eight components of the exocyst complex, including this protein, are found to interact with the actin cytoskeletal remodeling and vesicle transport machinery. This interaction has been shown to mediate filopodia formation in fibroblasts. This protein has been shown to interact with the Ral subfamily of GTPases and thereby mediate exocytosis by tethering vesicles to the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2012]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,126,473		noncoding transcript	Het
Adam24	A	G	8: 40,681,064	M524V	probably benign	Het
Adamts20	T	A	15: 94,281,957	N1788I	possibly damaging	Het
Arfgef3	T	G	10: 18,611,237	I1350L	probably damaging	Het
Arhgap17	A	G	7: 123,297,493		probably null	Het
Ascl5	A	T	1: 136,051,188	I129F	probably damaging	Het
AU040320	A	T	4: 126,823,716	H362L	possibly damaging	Het
Bpifb9a	A	T	2: 154,270,235	N564Y	probably benign	Het
Cdon	G	T	9: 35,470,035	D574Y	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Ces1e	T	A	8: 93,210,442	I334F	possibly damaging	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Cntn3	T	A	6: 102,278,353	T195S	probably benign	Het
Csmd2	C	A	4: 128,548,819	H3221Q	probably benign	Het
Cyp2c68	T	C	19: 39,699,284	D423G	possibly damaging	Het
Dennd3	C	T	15: 73,547,448	T696M	probably benign	Het
Ep300	T	C	15: 81,648,854	M1704T	unknown	Het
Fis1	A	G	5: 136,965,566	E36G	probably damaging	Het
Galnt1	A	G	18: 24,267,547	I237V	probably benign	Het
Gspt1	A	T	16: 11,230,510	I416N	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hykk	G	A	9: 54,946,066	C224Y	probably damaging	Het
Ifi211	T	C	1: 173,906,263	T111A	probably benign	Het
Il17rd	T	C	14: 27,095,911	Y186H	probably damaging	Het
Klhl29	G	T	12: 5,091,366	N539K	probably benign	Het
Lmbr1l	T	C	15: 98,909,262	T213A	probably damaging	Het
Madd	C	T	2: 91,154,514	R1318Q	probably damaging	Het
Mecom	C	A	3: 29,997,721	A182S	probably benign	Het
Olfr1305	C	T	2: 111,873,292	A188T	probably damaging	Het
Olfr20	C	T	11: 73,353,806	P18S	probably benign	Het
Olfr272	C	A	4: 52,910,991	A268S	probably benign	Het
Olfr67	A	T	7: 103,787,374	V301E	probably damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
Pdia5	A	G	16: 35,453,536	V130A	probably damaging	Het
Phldb2	T	A	16: 45,825,612	H202L	possibly damaging	Het
Ppig	G	A	2: 69,735,897	G136E	probably null	Het
Prr14l	C	A	5: 32,827,777	R1458L	probably damaging	Het
Ptpn3	T	C	4: 57,205,019	Y714C	probably damaging	Het
Ptprr	T	C	10: 116,188,330	V182A	possibly damaging	Het
Rai14	A	G	15: 10,574,938	Y645H	probably damaging	Het
Rasgrp3	T	C	17: 75,497,047	I115T	probably benign	Het
Rc3h1	G	T	1: 160,964,963	R990L	possibly damaging	Het
Rdh5	T	A	10: 128,918,291	Q21L	probably benign	Het
Rfx8	A	G	1: 39,710,156		probably null	Het
Scap	A	G	9: 110,374,182		probably null	Het
Shank1	T	A	7: 44,351,822	S988R	unknown	Het
Slc16a14	T	A	1: 84,907,424	I465F	probably damaging	Het
Slc41a2	A	G	10: 83,281,368		probably null	Het
Tab2	T	C	10: 7,919,821	H225R	possibly damaging	Het
Tbx19	T	A	1: 165,160,372	N64I	probably damaging	Het
Tmprss11f	A	T	5: 86,530,106	I268K	probably damaging	Het
Tox2	A	G	2: 163,320,373	M388V	probably benign	Het
Trbv17	T	C	6: 41,163,538	L109P	probably damaging	Het
Trim72	A	G	7: 128,009,923	H299R	probably damaging	Het
Vmn1r63	C	T	7: 5,803,190	V148I	possibly damaging	Het
Zfp938	A	C	10: 82,225,258	H509Q	possibly damaging	Het
Zfyve16	A	G	13: 92,521,231	V724A	probably benign	Het
Zscan10	T	C	17: 23,610,421	F569L	probably damaging	Het

Other mutations in Exoc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Exoc2	APN	13	30820626	missense	probably benign	0.17
IGL01839:Exoc2	APN	13	30906799	missense	probably damaging	1.00
IGL02092:Exoc2	APN	13	30875277	missense	probably benign	0.09
IGL02245:Exoc2	APN	13	30906859	missense	probably benign	0.10
IGL02267:Exoc2	APN	13	30815321	missense	probably benign
IGL02478:Exoc2	APN	13	30927420	missense	probably benign
IGL02500:Exoc2	APN	13	30911196	missense	probably damaging	1.00
IGL03081:Exoc2	APN	13	30900902	missense	probably benign	0.28
IGL03112:Exoc2	APN	13	30906587	splice site	probably benign
IGL03409:Exoc2	APN	13	30940737	utr 5 prime	probably benign
R0284:Exoc2	UTSW	13	30877625	splice site	probably benign
R0452:Exoc2	UTSW	13	30886327	splice site	probably benign
R0826:Exoc2	UTSW	13	30856797	critical splice acceptor site	probably null
R1251:Exoc2	UTSW	13	30886276	missense	probably benign	0.03
R1367:Exoc2	UTSW	13	30882273	nonsense	probably null
R1501:Exoc2	UTSW	13	30935502	missense	probably benign	0.01
R1593:Exoc2	UTSW	13	30856761	missense	possibly damaging	0.64
R1839:Exoc2	UTSW	13	30906497	splice site	probably benign
R1872:Exoc2	UTSW	13	30822661	missense	probably benign	0.17
R2064:Exoc2	UTSW	13	30935561	missense	probably benign	0.00
R2070:Exoc2	UTSW	13	30815370	missense	probably benign	0.00
R2227:Exoc2	UTSW	13	30864884	missense	probably benign
R2507:Exoc2	UTSW	13	30882365	missense	possibly damaging	0.55
R3965:Exoc2	UTSW	13	30877582	missense	probably benign	0.00
R4601:Exoc2	UTSW	13	30882268	missense	probably benign	0.05
R4914:Exoc2	UTSW	13	30876813	missense	probably benign	0.21
R5299:Exoc2	UTSW	13	30871918	splice site	probably null
R5461:Exoc2	UTSW	13	30925755	missense	possibly damaging	0.66
R5956:Exoc2	UTSW	13	30820623	missense	probably benign	0.03
R6056:Exoc2	UTSW	13	30900829	missense	probably benign	0.03
R6107:Exoc2	UTSW	13	30876797	missense	probably benign
R6548:Exoc2	UTSW	13	30826064	missense	possibly damaging	0.86
R6692:Exoc2	UTSW	13	30935507	missense	probably benign	0.09
R6969:Exoc2	UTSW	13	30911178	missense	probably benign
R7386:Exoc2	UTSW	13	30906663	splice site	probably null
R7461:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7467:Exoc2	UTSW	13	30925733	missense	probably damaging	0.98
R7473:Exoc2	UTSW	13	30822630	critical splice donor site	probably null
R7613:Exoc2	UTSW	13	30882272	missense	probably benign	0.32
R7767:Exoc2	UTSW	13	30876769	missense	probably benign	0.01
R7793:Exoc2	UTSW	13	30911178	missense	probably benign	0.00
R7795:Exoc2	UTSW	13	30876773	nonsense	probably null
R7993:Exoc2	UTSW	13	30906730	critical splice donor site	probably null
R8085:Exoc2	UTSW	13	30940703	missense	probably damaging	1.00
R8330:Exoc2	UTSW	13	30877573	missense	probably benign
R8716:Exoc2	UTSW	13	30911244	missense	probably damaging	1.00
R8735:Exoc2	UTSW	13	30906839	missense	probably damaging	1.00
R8922:Exoc2	UTSW	13	30871855	missense	probably benign	0.05
R9237:Exoc2	UTSW	13	30864875	missense	probably benign
R9243:Exoc2	UTSW	13	30925795	missense	probably benign	0.03
R9365:Exoc2	UTSW	13	30856714	missense	probably benign	0.00
R9731:Exoc2	UTSW	13	30877250	missense	probably benign	0.06

Predicted Primers

PCR Primer
(F):5'- TGCTCCTGAGTAAAGCAGTG -3'
(R):5'- GCATAGGATATTGATGTTAAAGGGC -3'

Sequencing Primer
(F):5'- CCTGAGTAAAGCAGTGTTACATTAAC -3'
(R):5'- CAGAAGCCTATCACTGTACTTAATAC -3'

Posted On

2016-09-01