Mutagenetix > Incidental Mutation

Incidental Mutation 'R5410:Zfyve16'

426521

Institutional Source

Beutler Lab

Gene Symbol

Zfyve16

Ensembl Gene

ENSMUSG00000021706

Gene Name

zinc finger, FYVE domain containing 16

Synonyms

B130024H06Rik

MMRRC Submission

042979-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.153) question?

Stock #

R5410 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

92487108-92530868 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 92521231 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 724 (V724A)

Ref Sequence

ENSEMBL: ENSMUSP00000022217 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022217]

AlphaFold

Q80U44

Predicted Effect

probably benign
Transcript: ENSMUST00000022217
AA Change: V724A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000022217
Gene: ENSMUSG00000021706
AA Change: V724A

Domain	Start	End	E-Value	Type
low complexity region	163	175	N/A	INTRINSIC
low complexity region	367	381	N/A	INTRINSIC
low complexity region	438	449	N/A	INTRINSIC
low complexity region	455	484	N/A	INTRINSIC
low complexity region	569	580	N/A	INTRINSIC
FYVE	727	794	7.25e-31	SMART
low complexity region	821	838	N/A	INTRINSIC
low complexity region	1002	1014	N/A	INTRINSIC
low complexity region	1050	1063	N/A	INTRINSIC
Pfam:DUF3480	1155	1503	3.3e-169	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154850

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156586

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endosomal protein that belongs to the FYVE zinc finger family of proteins. The encoded protein is thought to regulate membrane trafficking in the endosome. This protein functions as a scaffold protein in the transforming growth factor-beta signaling pathway and is involved in positive and negative feedback regulation of the bone morphogenetic protein signaling pathway. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2013]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,126,473		noncoding transcript	Het
Adam24	A	G	8: 40,681,064	M524V	probably benign	Het
Adamts20	T	A	15: 94,281,957	N1788I	possibly damaging	Het
Arfgef3	T	G	10: 18,611,237	I1350L	probably damaging	Het
Arhgap17	A	G	7: 123,297,493		probably null	Het
Ascl5	A	T	1: 136,051,188	I129F	probably damaging	Het
AU040320	A	T	4: 126,823,716	H362L	possibly damaging	Het
Bpifb9a	A	T	2: 154,270,235	N564Y	probably benign	Het
Cdon	G	T	9: 35,470,035	D574Y	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Ces1e	T	A	8: 93,210,442	I334F	possibly damaging	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Cntn3	T	A	6: 102,278,353	T195S	probably benign	Het
Csmd2	C	A	4: 128,548,819	H3221Q	probably benign	Het
Cyp2c68	T	C	19: 39,699,284	D423G	possibly damaging	Het
Dennd3	C	T	15: 73,547,448	T696M	probably benign	Het
Ep300	T	C	15: 81,648,854	M1704T	unknown	Het
Exoc2	A	G	13: 30,864,856	F738S	probably damaging	Het
Fis1	A	G	5: 136,965,566	E36G	probably damaging	Het
Galnt1	A	G	18: 24,267,547	I237V	probably benign	Het
Gspt1	A	T	16: 11,230,510	I416N	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hykk	G	A	9: 54,946,066	C224Y	probably damaging	Het
Ifi211	T	C	1: 173,906,263	T111A	probably benign	Het
Il17rd	T	C	14: 27,095,911	Y186H	probably damaging	Het
Klhl29	G	T	12: 5,091,366	N539K	probably benign	Het
Lmbr1l	T	C	15: 98,909,262	T213A	probably damaging	Het
Madd	C	T	2: 91,154,514	R1318Q	probably damaging	Het
Mecom	C	A	3: 29,997,721	A182S	probably benign	Het
Olfr1305	C	T	2: 111,873,292	A188T	probably damaging	Het
Olfr20	C	T	11: 73,353,806	P18S	probably benign	Het
Olfr272	C	A	4: 52,910,991	A268S	probably benign	Het
Olfr67	A	T	7: 103,787,374	V301E	probably damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
Pdia5	A	G	16: 35,453,536	V130A	probably damaging	Het
Phldb2	T	A	16: 45,825,612	H202L	possibly damaging	Het
Ppig	G	A	2: 69,735,897	G136E	probably null	Het
Prr14l	C	A	5: 32,827,777	R1458L	probably damaging	Het
Ptpn3	T	C	4: 57,205,019	Y714C	probably damaging	Het
Ptprr	T	C	10: 116,188,330	V182A	possibly damaging	Het
Rai14	A	G	15: 10,574,938	Y645H	probably damaging	Het
Rasgrp3	T	C	17: 75,497,047	I115T	probably benign	Het
Rc3h1	G	T	1: 160,964,963	R990L	possibly damaging	Het
Rdh5	T	A	10: 128,918,291	Q21L	probably benign	Het
Rfx8	A	G	1: 39,710,156		probably null	Het
Scap	A	G	9: 110,374,182		probably null	Het
Shank1	T	A	7: 44,351,822	S988R	unknown	Het
Slc16a14	T	A	1: 84,907,424	I465F	probably damaging	Het
Slc41a2	A	G	10: 83,281,368		probably null	Het
Tab2	T	C	10: 7,919,821	H225R	possibly damaging	Het
Tbx19	T	A	1: 165,160,372	N64I	probably damaging	Het
Tmprss11f	A	T	5: 86,530,106	I268K	probably damaging	Het
Tox2	A	G	2: 163,320,373	M388V	probably benign	Het
Trbv17	T	C	6: 41,163,538	L109P	probably damaging	Het
Trim72	A	G	7: 128,009,923	H299R	probably damaging	Het
Vmn1r63	C	T	7: 5,803,190	V148I	possibly damaging	Het
Zfp938	A	C	10: 82,225,258	H509Q	possibly damaging	Het
Zscan10	T	C	17: 23,610,421	F569L	probably damaging	Het

Other mutations in Zfyve16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00481:Zfyve16	APN	13	92516538	missense	possibly damaging	0.56
IGL00737:Zfyve16	APN	13	92521118	nonsense	probably null
IGL00741:Zfyve16	APN	13	92524253	missense	probably damaging	1.00
IGL00753:Zfyve16	APN	13	92521118	nonsense	probably null
IGL01123:Zfyve16	APN	13	92492522	missense	probably damaging	1.00
IGL01149:Zfyve16	APN	13	92508283	missense	probably damaging	1.00
IGL01414:Zfyve16	APN	13	92522196	missense	probably benign	0.04
IGL01771:Zfyve16	APN	13	92522172	missense	probably benign	0.38
IGL01889:Zfyve16	APN	13	92522569	missense	possibly damaging	0.87
IGL01928:Zfyve16	APN	13	92504498	missense	probably damaging	0.97
IGL02524:Zfyve16	APN	13	92504514	missense	probably benign	0.19
IGL03102:Zfyve16	APN	13	92511817	missense	possibly damaging	0.57
IGL03192:Zfyve16	APN	13	92521240	missense	possibly damaging	0.94
PIT4151001:Zfyve16	UTSW	13	92521204	missense	probably damaging	0.99
R0321:Zfyve16	UTSW	13	92492534	missense	probably damaging	0.99
R0548:Zfyve16	UTSW	13	92494944	missense	probably benign	0.00
R0555:Zfyve16	UTSW	13	92516520	splice site	probably benign
R0616:Zfyve16	UTSW	13	92521129	missense	probably damaging	1.00
R0727:Zfyve16	UTSW	13	92493878	missense	possibly damaging	0.81
R0730:Zfyve16	UTSW	13	92521477	missense	probably damaging	0.98
R1221:Zfyve16	UTSW	13	92508305	missense	possibly damaging	0.87
R1297:Zfyve16	UTSW	13	92522332	missense	probably benign	0.41
R1597:Zfyve16	UTSW	13	92508247	missense	probably benign	0.02
R1635:Zfyve16	UTSW	13	92509020	missense	probably damaging	1.00
R1803:Zfyve16	UTSW	13	92504085	missense	probably damaging	1.00
R1840:Zfyve16	UTSW	13	92511525	missense	possibly damaging	0.79
R1962:Zfyve16	UTSW	13	92522744	missense	possibly damaging	0.74
R2029:Zfyve16	UTSW	13	92504477	missense	probably damaging	0.98
R2083:Zfyve16	UTSW	13	92524262	missense	probably damaging	1.00
R2122:Zfyve16	UTSW	13	92519483	nonsense	probably null
R2173:Zfyve16	UTSW	13	92495088	missense	probably damaging	0.99
R3822:Zfyve16	UTSW	13	92521261	missense	probably damaging	1.00
R3857:Zfyve16	UTSW	13	92494971	missense	probably damaging	1.00
R4043:Zfyve16	UTSW	13	92513763	splice site	probably null
R4056:Zfyve16	UTSW	13	92504549	missense	probably damaging	1.00
R4495:Zfyve16	UTSW	13	92488567	missense	probably benign	0.25
R4518:Zfyve16	UTSW	13	92521312	missense	possibly damaging	0.86
R4835:Zfyve16	UTSW	13	92522185	missense	probably benign	0.18
R4862:Zfyve16	UTSW	13	92508256	missense	probably damaging	1.00
R4962:Zfyve16	UTSW	13	92513894	missense	probably damaging	1.00
R5117:Zfyve16	UTSW	13	92505689	missense	possibly damaging	0.95
R5344:Zfyve16	UTSW	13	92521588	missense	possibly damaging	0.79
R5358:Zfyve16	UTSW	13	92508263	missense	probably benign	0.04
R5407:Zfyve16	UTSW	13	92500284	missense	probably damaging	1.00
R5704:Zfyve16	UTSW	13	92504471	splice site	probably null
R5731:Zfyve16	UTSW	13	92508193	missense	probably benign	0.11
R5808:Zfyve16	UTSW	13	92495055	nonsense	probably null
R5828:Zfyve16	UTSW	13	92513902	missense	probably damaging	1.00
R5928:Zfyve16	UTSW	13	92522117	missense	probably benign	0.01
R6044:Zfyve16	UTSW	13	92522666	nonsense	probably null
R6141:Zfyve16	UTSW	13	92511597	missense	probably benign	0.00
R6538:Zfyve16	UTSW	13	92504516	missense	probably damaging	1.00
R6594:Zfyve16	UTSW	13	92513818	missense	probably benign	0.23
R6767:Zfyve16	UTSW	13	92508199	missense	probably damaging	1.00
R6942:Zfyve16	UTSW	13	92516631	missense	probably benign
R7011:Zfyve16	UTSW	13	92521987	missense	probably benign	0.00
R7381:Zfyve16	UTSW	13	92521146	missense	probably damaging	1.00
R7531:Zfyve16	UTSW	13	92522965	missense	probably damaging	1.00
R7617:Zfyve16	UTSW	13	92504562	missense	probably damaging	1.00
R7831:Zfyve16	UTSW	13	92522328	missense	probably benign	0.05
R8127:Zfyve16	UTSW	13	92505677	missense	probably damaging	1.00
R8382:Zfyve16	UTSW	13	92513820	missense	probably benign
R8467:Zfyve16	UTSW	13	92508282	missense	probably damaging	1.00
R8765:Zfyve16	UTSW	13	92521547	missense	probably benign	0.15
R8792:Zfyve16	UTSW	13	92523161	missense	probably benign	0.08
R9112:Zfyve16	UTSW	13	92523055	missense	possibly damaging	0.75
R9169:Zfyve16	UTSW	13	92521363	missense	probably damaging	1.00
R9599:Zfyve16	UTSW	13	92500255	missense	probably damaging	1.00
R9608:Zfyve16	UTSW	13	92500280	missense	probably damaging	1.00
R9636:Zfyve16	UTSW	13	92494948	missense	probably benign	0.17
R9669:Zfyve16	UTSW	13	92519499	missense	probably damaging	0.99
R9685:Zfyve16	UTSW	13	92522803	missense	possibly damaging	0.75
Z1176:Zfyve16	UTSW	13	92492663	missense	possibly damaging	0.95
Z1177:Zfyve16	UTSW	13	92522996	missense	possibly damaging	0.87

Predicted Primers

PCR Primer
(F):5'- GACAAGTAACTCAGAGTTTTCCTGG -3'
(R):5'- TGTGCCAGAAAGTGAGCCATG -3'

Sequencing Primer
(F):5'- TGTGAGGACCTGTTTTTAATCCCCAG -3'
(R):5'- AGTGAGCCATGCACAGC -3'

Posted On

2016-09-01