Incidental Mutation 'R5410:Rai14'
ID 426523
Institutional Source Beutler Lab
Gene Symbol Rai14
Ensembl Gene ENSMUSG00000022246
Gene Name retinoic acid induced 14
Synonyms 1700020L11Rik, Ankycorbin, 1700008J19Rik, Norpeg
MMRRC Submission 042979-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.654) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 10569055-10714710 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 10575024 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 645 (Y645H)
Ref Sequence ENSEMBL: ENSMUSP00000153969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090339] [ENSMUST00000169385] [ENSMUST00000227506]
AlphaFold Q9EP71
Predicted Effect probably damaging
Transcript: ENSMUST00000090339
AA Change: Y674H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000087815
Gene: ENSMUSG00000022246
AA Change: Y674H

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000169385
AA Change: Y674H

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126325
Gene: ENSMUSG00000022246
AA Change: Y674H

DomainStartEndE-ValueType
Blast:ANK 18 48 4e-10 BLAST
ANK 52 81 1.66e-6 SMART
ANK 85 117 7.02e-5 SMART
ANK 118 147 2.1e-3 SMART
ANK 151 180 2.16e-5 SMART
ANK 184 213 2.85e-5 SMART
ANK 217 247 9.33e2 SMART
low complexity region 343 357 N/A INTRINSIC
Blast:HAMP 595 646 6e-19 BLAST
low complexity region 897 931 N/A INTRINSIC
Blast:ANK 944 977 6e-13 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000227506
AA Change: Y645H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 41,134,103 (GRCm39) M524V probably benign Het
Adamts20 T A 15: 94,179,838 (GRCm39) N1788I possibly damaging Het
Arfgef3 T G 10: 18,486,985 (GRCm39) I1350L probably damaging Het
Arhgap17 A G 7: 122,896,716 (GRCm39) probably null Het
Ascl5 A T 1: 135,978,926 (GRCm39) I129F probably damaging Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bpifb9a A T 2: 154,112,155 (GRCm39) N564Y probably benign Het
Cdon G T 9: 35,381,331 (GRCm39) D574Y probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Ces1e T A 8: 93,937,070 (GRCm39) I334F possibly damaging Het
Clip2 G A 5: 134,551,645 (GRCm39) T159M possibly damaging Het
Cntn3 T A 6: 102,255,314 (GRCm39) T195S probably benign Het
Csmd2 C A 4: 128,442,612 (GRCm39) H3221Q probably benign Het
Cyp2c68 T C 19: 39,687,728 (GRCm39) D423G possibly damaging Het
Dennd3 C T 15: 73,419,297 (GRCm39) T696M probably benign Het
Ep300 T C 15: 81,533,055 (GRCm39) M1704T unknown Het
Exoc2 A G 13: 31,048,839 (GRCm39) F738S probably damaging Het
Fis1 A G 5: 136,994,420 (GRCm39) E36G probably damaging Het
Galnt1 A G 18: 24,400,604 (GRCm39) I237V probably benign Het
Gspt1 A T 16: 11,048,374 (GRCm39) I416N probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hykk G A 9: 54,853,350 (GRCm39) C224Y probably damaging Het
Ifi211 T C 1: 173,733,829 (GRCm39) T111A probably benign Het
Il17rd T C 14: 26,817,868 (GRCm39) Y186H probably damaging Het
Klhl29 G T 12: 5,141,366 (GRCm39) N539K probably benign Het
Lmbr1l T C 15: 98,807,143 (GRCm39) T213A probably damaging Het
Madd C T 2: 90,984,859 (GRCm39) R1318Q probably damaging Het
Mecom C A 3: 30,051,870 (GRCm39) A182S probably benign Het
Or13c25 C A 4: 52,910,991 (GRCm39) A268S probably benign Het
Or1e1 C T 11: 73,244,632 (GRCm39) P18S probably benign Het
Or4f56 C T 2: 111,703,637 (GRCm39) A188T probably damaging Het
Or52z1 A T 7: 103,436,581 (GRCm39) V301E probably damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
Pdia5 A G 16: 35,273,906 (GRCm39) V130A probably damaging Het
Phldb2 T A 16: 45,645,975 (GRCm39) H202L possibly damaging Het
Ppig G A 2: 69,566,241 (GRCm39) G136E probably null Het
Prr14l C A 5: 32,985,121 (GRCm39) R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 (GRCm39) Y714C probably damaging Het
Ptprr T C 10: 116,024,235 (GRCm39) V182A possibly damaging Het
Rasgrp3 T C 17: 75,804,042 (GRCm39) I115T probably benign Het
Rc3h1 G T 1: 160,792,533 (GRCm39) R990L possibly damaging Het
Rdh5 T A 10: 128,754,160 (GRCm39) Q21L probably benign Het
Rfx8 A G 1: 39,749,316 (GRCm39) probably null Het
Scap A G 9: 110,203,250 (GRCm39) probably null Het
Shank1 T A 7: 44,001,246 (GRCm39) S988R unknown Het
Slc16a14 T A 1: 84,885,145 (GRCm39) I465F probably damaging Het
Slc41a2 A G 10: 83,117,232 (GRCm39) probably null Het
Tab2 T C 10: 7,795,585 (GRCm39) H225R possibly damaging Het
Tbx19 T A 1: 164,987,941 (GRCm39) N64I probably damaging Het
Tmprss11f A T 5: 86,677,965 (GRCm39) I268K probably damaging Het
Tox2 A G 2: 163,162,293 (GRCm39) M388V probably benign Het
Trbv17 T C 6: 41,140,472 (GRCm39) L109P probably damaging Het
Trim72 A G 7: 127,609,095 (GRCm39) H299R probably damaging Het
Ulbp3 G A 10: 3,076,473 (GRCm39) noncoding transcript Het
Vmn1r63 C T 7: 5,806,189 (GRCm39) V148I possibly damaging Het
Zfp938 A C 10: 82,061,092 (GRCm39) H509Q possibly damaging Het
Zfyve16 A G 13: 92,657,739 (GRCm39) V724A probably benign Het
Zscan10 T C 17: 23,829,395 (GRCm39) F569L probably damaging Het
Other mutations in Rai14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01107:Rai14 APN 15 10,599,797 (GRCm39) splice site probably benign
IGL01625:Rai14 APN 15 10,572,460 (GRCm39) missense probably benign 0.30
IGL01925:Rai14 APN 15 10,595,948 (GRCm39) missense possibly damaging 0.88
IGL02053:Rai14 APN 15 10,633,242 (GRCm39) missense probably benign 0.00
IGL02531:Rai14 APN 15 10,574,868 (GRCm39) missense probably damaging 1.00
IGL02748:Rai14 APN 15 10,589,421 (GRCm39) missense probably benign 0.14
IGL02945:Rai14 APN 15 10,574,795 (GRCm39) missense probably benign 0.00
PIT4618001:Rai14 UTSW 15 10,575,242 (GRCm39) missense probably damaging 1.00
R1400:Rai14 UTSW 15 10,571,634 (GRCm39) missense probably damaging 0.98
R1583:Rai14 UTSW 15 10,588,002 (GRCm39) missense probably damaging 1.00
R1686:Rai14 UTSW 15 10,592,282 (GRCm39) missense probably damaging 0.98
R1721:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1867:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1868:Rai14 UTSW 15 10,633,314 (GRCm39) missense probably damaging 1.00
R1998:Rai14 UTSW 15 10,595,067 (GRCm39) splice site probably null
R2118:Rai14 UTSW 15 10,575,252 (GRCm39) missense probably benign 0.00
R3161:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R3162:Rai14 UTSW 15 10,633,250 (GRCm39) missense possibly damaging 0.74
R4049:Rai14 UTSW 15 10,592,298 (GRCm39) missense probably benign 0.30
R4611:Rai14 UTSW 15 10,592,224 (GRCm39) missense probably damaging 1.00
R4760:Rai14 UTSW 15 10,575,776 (GRCm39) missense possibly damaging 0.60
R4863:Rai14 UTSW 15 10,572,556 (GRCm39) missense probably damaging 0.99
R5022:Rai14 UTSW 15 10,574,592 (GRCm39) missense probably damaging 0.96
R5110:Rai14 UTSW 15 10,690,496 (GRCm39) start gained probably benign
R5643:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5644:Rai14 UTSW 15 10,593,137 (GRCm39) missense probably benign 0.03
R5681:Rai14 UTSW 15 10,575,206 (GRCm39) missense probably damaging 1.00
R5934:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably damaging 0.98
R6333:Rai14 UTSW 15 10,575,022 (GRCm39) nonsense probably null
R6338:Rai14 UTSW 15 10,575,062 (GRCm39) missense probably damaging 1.00
R6864:Rai14 UTSW 15 10,633,254 (GRCm39) missense possibly damaging 0.95
R7015:Rai14 UTSW 15 10,589,401 (GRCm39) nonsense probably null
R7155:Rai14 UTSW 15 10,595,089 (GRCm39) missense possibly damaging 0.53
R7480:Rai14 UTSW 15 10,571,622 (GRCm39) missense probably benign 0.02
R7574:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7578:Rai14 UTSW 15 10,574,914 (GRCm39) missense probably benign
R7597:Rai14 UTSW 15 10,574,937 (GRCm39) missense possibly damaging 0.94
R7658:Rai14 UTSW 15 10,593,189 (GRCm39) missense probably damaging 1.00
R7779:Rai14 UTSW 15 10,593,112 (GRCm39) missense probably damaging 1.00
R7946:Rai14 UTSW 15 10,574,287 (GRCm39) splice site probably null
R8171:Rai14 UTSW 15 10,633,249 (GRCm39) missense probably damaging 1.00
R8195:Rai14 UTSW 15 10,575,302 (GRCm39) missense probably benign
R8471:Rai14 UTSW 15 10,575,245 (GRCm39) missense probably benign 0.01
R8485:Rai14 UTSW 15 10,575,122 (GRCm39) missense probably damaging 1.00
R9075:Rai14 UTSW 15 10,589,403 (GRCm39) missense probably damaging 1.00
R9287:Rai14 UTSW 15 10,592,204 (GRCm39) missense probably benign 0.14
R9502:Rai14 UTSW 15 10,587,947 (GRCm39) missense possibly damaging 0.50
R9603:Rai14 UTSW 15 10,595,116 (GRCm39) nonsense probably null
R9665:Rai14 UTSW 15 10,574,803 (GRCm39) missense probably damaging 1.00
R9767:Rai14 UTSW 15 10,610,127 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTGTCCGCAGCGTGGTTATC -3'
(R):5'- ATCATGAAACTGAAGGACACGC -3'

Sequencing Primer
(F):5'- TGCAAATGCTCTGTGATGGACAC -3'
(R):5'- GGACACGCTAAAAAGTCAGATGCC -3'
Posted On 2016-09-01