Incidental Mutation 'R5410:Adamts20'
ID 426526
Institutional Source Beutler Lab
Gene Symbol Adamts20
Ensembl Gene ENSMUSG00000022449
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 20
Synonyms ADAMTS-20, bt
MMRRC Submission 042979-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.207) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 94166177-94329966 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 94179838 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 1788 (N1788I)
Ref Sequence ENSEMBL: ENSMUSP00000036330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035342]
AlphaFold P59511
Predicted Effect possibly damaging
Transcript: ENSMUST00000035342
AA Change: N1788I

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: N1788I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Pep_M12B_propep 41 186 1.4e-30 PFAM
Pfam:Reprolysin_5 253 445 3.6e-13 PFAM
Pfam:Reprolysin_4 253 460 1.1e-7 PFAM
Pfam:Reprolysin 255 464 1.5e-26 PFAM
Pfam:Reprolysin_2 272 454 1.8e-10 PFAM
Pfam:Reprolysin_3 276 410 5.8e-10 PFAM
TSP1 556 608 7.73e-11 SMART
Pfam:ADAM_spacer1 718 836 2.6e-34 PFAM
TSP1 846 901 1.47e-1 SMART
TSP1 904 958 2.83e0 SMART
TSP1 965 1019 4.28e-4 SMART
TSP1 1020 1074 1.89e-5 SMART
TSP1 1075 1131 4.87e-8 SMART
TSP1 1152 1201 6.05e-4 SMART
TSP1 1204 1260 1.22e-8 SMART
TSP1 1304 1356 1.37e-2 SMART
TSP1 1357 1411 6e-8 SMART
TSP1 1416 1470 1.69e-2 SMART
TSP1 1471 1526 2.3e0 SMART
TSP1 1530 1579 1.23e0 SMART
TSP1 1653 1706 5.27e-4 SMART
Pfam:GON 1708 1905 5.8e-80 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]
Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 41,134,103 (GRCm39) M524V probably benign Het
Arfgef3 T G 10: 18,486,985 (GRCm39) I1350L probably damaging Het
Arhgap17 A G 7: 122,896,716 (GRCm39) probably null Het
Ascl5 A T 1: 135,978,926 (GRCm39) I129F probably damaging Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bpifb9a A T 2: 154,112,155 (GRCm39) N564Y probably benign Het
Cdon G T 9: 35,381,331 (GRCm39) D574Y probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Ces1e T A 8: 93,937,070 (GRCm39) I334F possibly damaging Het
Clip2 G A 5: 134,551,645 (GRCm39) T159M possibly damaging Het
Cntn3 T A 6: 102,255,314 (GRCm39) T195S probably benign Het
Csmd2 C A 4: 128,442,612 (GRCm39) H3221Q probably benign Het
Cyp2c68 T C 19: 39,687,728 (GRCm39) D423G possibly damaging Het
Dennd3 C T 15: 73,419,297 (GRCm39) T696M probably benign Het
Ep300 T C 15: 81,533,055 (GRCm39) M1704T unknown Het
Exoc2 A G 13: 31,048,839 (GRCm39) F738S probably damaging Het
Fis1 A G 5: 136,994,420 (GRCm39) E36G probably damaging Het
Galnt1 A G 18: 24,400,604 (GRCm39) I237V probably benign Het
Gspt1 A T 16: 11,048,374 (GRCm39) I416N probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hykk G A 9: 54,853,350 (GRCm39) C224Y probably damaging Het
Ifi211 T C 1: 173,733,829 (GRCm39) T111A probably benign Het
Il17rd T C 14: 26,817,868 (GRCm39) Y186H probably damaging Het
Klhl29 G T 12: 5,141,366 (GRCm39) N539K probably benign Het
Lmbr1l T C 15: 98,807,143 (GRCm39) T213A probably damaging Het
Madd C T 2: 90,984,859 (GRCm39) R1318Q probably damaging Het
Mecom C A 3: 30,051,870 (GRCm39) A182S probably benign Het
Or13c25 C A 4: 52,910,991 (GRCm39) A268S probably benign Het
Or1e1 C T 11: 73,244,632 (GRCm39) P18S probably benign Het
Or4f56 C T 2: 111,703,637 (GRCm39) A188T probably damaging Het
Or52z1 A T 7: 103,436,581 (GRCm39) V301E probably damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
Pdia5 A G 16: 35,273,906 (GRCm39) V130A probably damaging Het
Phldb2 T A 16: 45,645,975 (GRCm39) H202L possibly damaging Het
Ppig G A 2: 69,566,241 (GRCm39) G136E probably null Het
Prr14l C A 5: 32,985,121 (GRCm39) R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 (GRCm39) Y714C probably damaging Het
Ptprr T C 10: 116,024,235 (GRCm39) V182A possibly damaging Het
Rai14 A G 15: 10,575,024 (GRCm39) Y645H probably damaging Het
Rasgrp3 T C 17: 75,804,042 (GRCm39) I115T probably benign Het
Rc3h1 G T 1: 160,792,533 (GRCm39) R990L possibly damaging Het
Rdh5 T A 10: 128,754,160 (GRCm39) Q21L probably benign Het
Rfx8 A G 1: 39,749,316 (GRCm39) probably null Het
Scap A G 9: 110,203,250 (GRCm39) probably null Het
Shank1 T A 7: 44,001,246 (GRCm39) S988R unknown Het
Slc16a14 T A 1: 84,885,145 (GRCm39) I465F probably damaging Het
Slc41a2 A G 10: 83,117,232 (GRCm39) probably null Het
Tab2 T C 10: 7,795,585 (GRCm39) H225R possibly damaging Het
Tbx19 T A 1: 164,987,941 (GRCm39) N64I probably damaging Het
Tmprss11f A T 5: 86,677,965 (GRCm39) I268K probably damaging Het
Tox2 A G 2: 163,162,293 (GRCm39) M388V probably benign Het
Trbv17 T C 6: 41,140,472 (GRCm39) L109P probably damaging Het
Trim72 A G 7: 127,609,095 (GRCm39) H299R probably damaging Het
Ulbp3 G A 10: 3,076,473 (GRCm39) noncoding transcript Het
Vmn1r63 C T 7: 5,806,189 (GRCm39) V148I possibly damaging Het
Zfp938 A C 10: 82,061,092 (GRCm39) H509Q possibly damaging Het
Zfyve16 A G 13: 92,657,739 (GRCm39) V724A probably benign Het
Zscan10 T C 17: 23,829,395 (GRCm39) F569L probably damaging Het
Other mutations in Adamts20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Adamts20 APN 15 94,292,522 (GRCm39) missense probably benign
IGL00491:Adamts20 APN 15 94,171,113 (GRCm39) missense possibly damaging 0.89
IGL00502:Adamts20 APN 15 94,301,278 (GRCm39) missense probably damaging 0.99
IGL00672:Adamts20 APN 15 94,238,986 (GRCm39) missense probably damaging 0.99
IGL00840:Adamts20 APN 15 94,180,363 (GRCm39) missense probably damaging 1.00
IGL00909:Adamts20 APN 15 94,277,694 (GRCm39) missense probably damaging 1.00
IGL01101:Adamts20 APN 15 94,241,923 (GRCm39) missense probably damaging 1.00
IGL01137:Adamts20 APN 15 94,292,492 (GRCm39) critical splice donor site probably null
IGL01457:Adamts20 APN 15 94,229,329 (GRCm39) missense probably damaging 0.97
IGL01685:Adamts20 APN 15 94,301,327 (GRCm39) missense possibly damaging 0.81
IGL01949:Adamts20 APN 15 94,223,987 (GRCm39) missense probably benign 0.08
IGL02525:Adamts20 APN 15 94,180,959 (GRCm39) splice site probably null
IGL03088:Adamts20 APN 15 94,227,795 (GRCm39) critical splice donor site probably null
IGL03175:Adamts20 APN 15 94,171,136 (GRCm39) nonsense probably null
belt UTSW 15 94,243,871 (GRCm39) missense probably damaging 1.00
buckeye UTSW 15 94,238,968 (GRCm39) missense probably damaging 1.00
jack_white UTSW 15 0 () unclassified
meowth UTSW 15 94,229,339 (GRCm39) missense probably damaging 1.00
nidoking UTSW 15 94,301,326 (GRCm39) missense probably damaging 1.00
panda UTSW 15 94,224,580 (GRCm39) intron probably benign
pikachu UTSW 15 94,243,871 (GRCm39) missense probably damaging 1.00
poliwag UTSW 15 94,292,503 (GRCm39) nonsense probably null
splotch2 UTSW 15 94,233,442 (GRCm39) intron probably benign
wash UTSW 15 94,245,551 (GRCm39) nonsense probably null
whitebelly UTSW 15 0 () unclassified
whopper UTSW 15 94,245,691 (GRCm39) missense probably damaging 1.00
R0483:Adamts20 UTSW 15 94,251,452 (GRCm39) missense probably benign 0.00
R0514:Adamts20 UTSW 15 94,168,257 (GRCm39) missense probably damaging 1.00
R0568:Adamts20 UTSW 15 94,189,594 (GRCm39) splice site probably benign
R0730:Adamts20 UTSW 15 94,245,571 (GRCm39) missense probably benign 0.00
R0973:Adamts20 UTSW 15 94,184,252 (GRCm39) missense probably benign 0.00
R1339:Adamts20 UTSW 15 94,220,777 (GRCm39) missense probably benign 0.19
R1721:Adamts20 UTSW 15 94,236,340 (GRCm39) missense probably benign 0.44
R1809:Adamts20 UTSW 15 94,238,968 (GRCm39) missense probably damaging 1.00
R1832:Adamts20 UTSW 15 94,184,225 (GRCm39) missense probably benign 0.00
R1846:Adamts20 UTSW 15 94,243,871 (GRCm39) missense probably damaging 1.00
R1867:Adamts20 UTSW 15 94,236,340 (GRCm39) missense probably benign 0.44
R1875:Adamts20 UTSW 15 94,229,277 (GRCm39) missense probably benign 0.01
R1930:Adamts20 UTSW 15 94,301,891 (GRCm39) missense probably benign 0.03
R1931:Adamts20 UTSW 15 94,301,891 (GRCm39) missense probably benign 0.03
R1932:Adamts20 UTSW 15 94,301,891 (GRCm39) missense probably benign 0.03
R2001:Adamts20 UTSW 15 94,245,599 (GRCm39) missense possibly damaging 0.96
R2116:Adamts20 UTSW 15 94,253,243 (GRCm39) missense probably damaging 1.00
R2162:Adamts20 UTSW 15 94,229,339 (GRCm39) missense probably damaging 1.00
R2350:Adamts20 UTSW 15 94,181,797 (GRCm39) missense probably damaging 1.00
R2887:Adamts20 UTSW 15 94,228,459 (GRCm39) missense probably benign 0.00
R2889:Adamts20 UTSW 15 94,228,459 (GRCm39) missense probably benign 0.00
R2890:Adamts20 UTSW 15 94,228,459 (GRCm39) missense probably benign 0.00
R3109:Adamts20 UTSW 15 94,243,785 (GRCm39) splice site probably benign
R3719:Adamts20 UTSW 15 94,259,719 (GRCm39) missense probably damaging 0.99
R3832:Adamts20 UTSW 15 94,229,339 (GRCm39) missense probably damaging 1.00
R3901:Adamts20 UTSW 15 94,226,726 (GRCm39) missense possibly damaging 0.81
R4398:Adamts20 UTSW 15 94,231,576 (GRCm39) missense possibly damaging 0.93
R4402:Adamts20 UTSW 15 94,277,827 (GRCm39) missense probably benign
R4431:Adamts20 UTSW 15 94,241,924 (GRCm39) missense probably damaging 1.00
R4479:Adamts20 UTSW 15 94,301,326 (GRCm39) missense probably damaging 1.00
R4482:Adamts20 UTSW 15 94,243,801 (GRCm39) missense probably damaging 1.00
R4503:Adamts20 UTSW 15 94,277,631 (GRCm39) missense probably damaging 0.99
R4671:Adamts20 UTSW 15 94,301,206 (GRCm39) missense possibly damaging 0.48
R4700:Adamts20 UTSW 15 94,292,503 (GRCm39) nonsense probably null
R4707:Adamts20 UTSW 15 94,231,528 (GRCm39) missense possibly damaging 0.53
R4725:Adamts20 UTSW 15 94,249,643 (GRCm39) missense probably damaging 0.99
R4771:Adamts20 UTSW 15 94,249,516 (GRCm39) splice site probably null
R4829:Adamts20 UTSW 15 94,224,277 (GRCm39) missense probably benign 0.01
R4937:Adamts20 UTSW 15 94,277,656 (GRCm39) missense probably benign
R4960:Adamts20 UTSW 15 94,277,655 (GRCm39) missense probably benign
R5270:Adamts20 UTSW 15 94,180,400 (GRCm39) missense probably benign 0.00
R5388:Adamts20 UTSW 15 94,243,659 (GRCm39) missense possibly damaging 0.81
R5453:Adamts20 UTSW 15 94,223,969 (GRCm39) missense possibly damaging 0.69
R5611:Adamts20 UTSW 15 94,171,161 (GRCm39) missense possibly damaging 0.65
R5687:Adamts20 UTSW 15 94,223,852 (GRCm39) missense probably benign 0.36
R5758:Adamts20 UTSW 15 94,292,531 (GRCm39) missense probably benign 0.00
R5801:Adamts20 UTSW 15 94,245,551 (GRCm39) nonsense probably null
R5834:Adamts20 UTSW 15 94,251,465 (GRCm39) missense probably damaging 0.99
R5993:Adamts20 UTSW 15 94,236,604 (GRCm39) missense probably damaging 0.99
R5997:Adamts20 UTSW 15 94,277,628 (GRCm39) missense probably damaging 1.00
R6044:Adamts20 UTSW 15 94,180,364 (GRCm39) missense probably damaging 1.00
R6058:Adamts20 UTSW 15 94,227,928 (GRCm39) nonsense probably null
R6217:Adamts20 UTSW 15 94,236,596 (GRCm39) missense probably benign 0.00
R6283:Adamts20 UTSW 15 94,249,602 (GRCm39) missense probably benign
R6354:Adamts20 UTSW 15 94,245,691 (GRCm39) missense probably damaging 1.00
R6415:Adamts20 UTSW 15 94,222,540 (GRCm39) critical splice donor site probably null
R6419:Adamts20 UTSW 15 94,231,556 (GRCm39) missense possibly damaging 0.84
R6476:Adamts20 UTSW 15 94,259,691 (GRCm39) missense probably benign 0.22
R6485:Adamts20 UTSW 15 94,241,852 (GRCm39) missense probably benign 0.17
R6517:Adamts20 UTSW 15 94,180,985 (GRCm39) splice site probably null
R6675:Adamts20 UTSW 15 94,229,197 (GRCm39) critical splice donor site probably null
R6863:Adamts20 UTSW 15 94,277,627 (GRCm39) nonsense probably null
R7186:Adamts20 UTSW 15 94,220,689 (GRCm39) missense possibly damaging 0.76
R7263:Adamts20 UTSW 15 94,220,772 (GRCm39) missense possibly damaging 0.52
R7441:Adamts20 UTSW 15 94,251,554 (GRCm39) missense probably damaging 1.00
R7519:Adamts20 UTSW 15 94,223,869 (GRCm39) missense possibly damaging 0.64
R7747:Adamts20 UTSW 15 94,189,468 (GRCm39) nonsense probably null
R7770:Adamts20 UTSW 15 94,231,579 (GRCm39) missense probably benign 0.02
R7816:Adamts20 UTSW 15 94,220,725 (GRCm39) missense probably benign 0.00
R7827:Adamts20 UTSW 15 94,223,814 (GRCm39) missense probably damaging 1.00
R7853:Adamts20 UTSW 15 94,243,871 (GRCm39) missense probably damaging 1.00
R7894:Adamts20 UTSW 15 94,249,641 (GRCm39) missense probably damaging 1.00
R7951:Adamts20 UTSW 15 94,238,947 (GRCm39) missense probably damaging 1.00
R8233:Adamts20 UTSW 15 94,189,533 (GRCm39) missense probably benign 0.19
R8458:Adamts20 UTSW 15 94,251,521 (GRCm39) missense probably benign 0.02
R8709:Adamts20 UTSW 15 94,238,947 (GRCm39) missense probably damaging 1.00
R8719:Adamts20 UTSW 15 94,241,903 (GRCm39) missense probably damaging 0.99
R8728:Adamts20 UTSW 15 94,229,281 (GRCm39) missense probably benign 0.00
R8787:Adamts20 UTSW 15 94,184,294 (GRCm39) missense possibly damaging 0.83
R8801:Adamts20 UTSW 15 94,258,490 (GRCm39) missense probably damaging 1.00
R9055:Adamts20 UTSW 15 94,181,867 (GRCm39) missense probably damaging 0.98
R9069:Adamts20 UTSW 15 94,236,349 (GRCm39) missense probably benign 0.00
R9297:Adamts20 UTSW 15 94,301,321 (GRCm39) missense possibly damaging 0.88
R9318:Adamts20 UTSW 15 94,301,321 (GRCm39) missense possibly damaging 0.88
R9362:Adamts20 UTSW 15 94,236,626 (GRCm39) missense possibly damaging 0.86
R9658:Adamts20 UTSW 15 94,249,626 (GRCm39) missense probably damaging 1.00
R9747:Adamts20 UTSW 15 94,180,943 (GRCm39) missense probably damaging 1.00
R9769:Adamts20 UTSW 15 94,251,459 (GRCm39) missense probably damaging 1.00
R9795:Adamts20 UTSW 15 94,301,180 (GRCm39) missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- AGGTCCCCATACTTCCTCAGAG -3'
(R):5'- GGAAGGACAGAAGTGTGCCTTC -3'

Sequencing Primer
(F):5'- GGAAACCATCTTGTACAACGGTTC -3'
(R):5'- GAAGTGTGCCTTCTGTTTTACC -3'
Posted On 2016-09-01