Mutagenetix > Incidental Mutation

Incidental Mutation 'R5410:Adamts20'

426526

Institutional Source

Beutler Lab

Gene Symbol

Adamts20

Ensembl Gene

ENSMUSG00000022449

Gene Name

a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 20

Synonyms

ADAMTS-20, bt

MMRRC Submission

042979-MU

Accession Numbers

Genbank: NM_177431; MGI: 2660628

Is this an essential gene?

Probably non essential (E-score: 0.235) question?

Stock #

R5410 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94270163-94465418 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 94281957 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 1788 (N1788I)

Ref Sequence

ENSEMBL: ENSMUSP00000036330 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035342]

AlphaFold

P59511

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035342
AA Change: N1788I

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000036330
Gene: ENSMUSG00000022449
AA Change: N1788I

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:Pep_M12B_propep	41	186	1.4e-30	PFAM
Pfam:Reprolysin_5	253	445	3.6e-13	PFAM
Pfam:Reprolysin_4	253	460	1.1e-7	PFAM
Pfam:Reprolysin	255	464	1.5e-26	PFAM
Pfam:Reprolysin_2	272	454	1.8e-10	PFAM
Pfam:Reprolysin_3	276	410	5.8e-10	PFAM
TSP1	556	608	7.73e-11	SMART
Pfam:ADAM_spacer1	718	836	2.6e-34	PFAM
TSP1	846	901	1.47e-1	SMART
TSP1	904	958	2.83e0	SMART
TSP1	965	1019	4.28e-4	SMART
TSP1	1020	1074	1.89e-5	SMART
TSP1	1075	1131	4.87e-8	SMART
TSP1	1152	1201	6.05e-4	SMART
TSP1	1204	1260	1.22e-8	SMART
TSP1	1304	1356	1.37e-2	SMART
TSP1	1357	1411	6e-8	SMART
TSP1	1416	1470	1.69e-2	SMART
TSP1	1471	1526	2.3e0	SMART
TSP1	1530	1579	1.23e0	SMART
TSP1	1653	1706	5.27e-4	SMART
Pfam:GON	1708	1905	5.8e-80	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active protease. Certain mutations in this gene cause defective development of neural crest-derived melanoblasts resulting in a "belted" phenotype that is characterized by white spots in the lumbar region. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for spontaneous or ENU-induced mutations exhibit abnormal coat/hair pigmentation, including a typical white belt phenotype. [provided by MGI curators]

Allele List at MGI

All alleles(17) : Targeted, other(1) Spontaneous(11) Chemically induced(5)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,126,473		noncoding transcript	Het
Adam24	A	G	8: 40,681,064	M524V	probably benign	Het
Arfgef3	T	G	10: 18,611,237	I1350L	probably damaging	Het
Arhgap17	A	G	7: 123,297,493		probably null	Het
Ascl5	A	T	1: 136,051,188	I129F	probably damaging	Het
AU040320	A	T	4: 126,823,716	H362L	possibly damaging	Het
Bpifb9a	A	T	2: 154,270,235	N564Y	probably benign	Het
Cdon	G	T	9: 35,470,035	D574Y	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Ces1e	T	A	8: 93,210,442	I334F	possibly damaging	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Cntn3	T	A	6: 102,278,353	T195S	probably benign	Het
Csmd2	C	A	4: 128,548,819	H3221Q	probably benign	Het
Cyp2c68	T	C	19: 39,699,284	D423G	possibly damaging	Het
Dennd3	C	T	15: 73,547,448	T696M	probably benign	Het
Ep300	T	C	15: 81,648,854	M1704T	unknown	Het
Exoc2	A	G	13: 30,864,856	F738S	probably damaging	Het
Fis1	A	G	5: 136,965,566	E36G	probably damaging	Het
Galnt1	A	G	18: 24,267,547	I237V	probably benign	Het
Gspt1	A	T	16: 11,230,510	I416N	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hykk	G	A	9: 54,946,066	C224Y	probably damaging	Het
Ifi211	T	C	1: 173,906,263	T111A	probably benign	Het
Il17rd	T	C	14: 27,095,911	Y186H	probably damaging	Het
Klhl29	G	T	12: 5,091,366	N539K	probably benign	Het
Lmbr1l	T	C	15: 98,909,262	T213A	probably damaging	Het
Madd	C	T	2: 91,154,514	R1318Q	probably damaging	Het
Mecom	C	A	3: 29,997,721	A182S	probably benign	Het
Olfr1305	C	T	2: 111,873,292	A188T	probably damaging	Het
Olfr20	C	T	11: 73,353,806	P18S	probably benign	Het
Olfr272	C	A	4: 52,910,991	A268S	probably benign	Het
Olfr67	A	T	7: 103,787,374	V301E	probably damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
Pdia5	A	G	16: 35,453,536	V130A	probably damaging	Het
Phldb2	T	A	16: 45,825,612	H202L	possibly damaging	Het
Ppig	G	A	2: 69,735,897	G136E	probably null	Het
Prr14l	C	A	5: 32,827,777	R1458L	probably damaging	Het
Ptpn3	T	C	4: 57,205,019	Y714C	probably damaging	Het
Ptprr	T	C	10: 116,188,330	V182A	possibly damaging	Het
Rai14	A	G	15: 10,574,938	Y645H	probably damaging	Het
Rasgrp3	T	C	17: 75,497,047	I115T	probably benign	Het
Rc3h1	G	T	1: 160,964,963	R990L	possibly damaging	Het
Rdh5	T	A	10: 128,918,291	Q21L	probably benign	Het
Rfx8	A	G	1: 39,710,156		probably null	Het
Scap	A	G	9: 110,374,182		probably null	Het
Shank1	T	A	7: 44,351,822	S988R	unknown	Het
Slc16a14	T	A	1: 84,907,424	I465F	probably damaging	Het
Slc41a2	A	G	10: 83,281,368		probably null	Het
Tab2	T	C	10: 7,919,821	H225R	possibly damaging	Het
Tbx19	T	A	1: 165,160,372	N64I	probably damaging	Het
Tmprss11f	A	T	5: 86,530,106	I268K	probably damaging	Het
Tox2	A	G	2: 163,320,373	M388V	probably benign	Het
Trbv17	T	C	6: 41,163,538	L109P	probably damaging	Het
Trim72	A	G	7: 128,009,923	H299R	probably damaging	Het
Vmn1r63	C	T	7: 5,803,190	V148I	possibly damaging	Het
Zfp938	A	C	10: 82,225,258	H509Q	possibly damaging	Het
Zfyve16	A	G	13: 92,521,231	V724A	probably benign	Het
Zscan10	T	C	17: 23,610,421	F569L	probably damaging	Het

Other mutations in Adamts20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Adamts20	APN	15	94394641	missense	probably benign
IGL00491:Adamts20	APN	15	94273232	missense	possibly damaging	0.89
IGL00502:Adamts20	APN	15	94403397	missense	probably damaging	0.99
IGL00672:Adamts20	APN	15	94341105	missense	probably damaging	0.99
IGL00840:Adamts20	APN	15	94282482	missense	probably damaging	1.00
IGL00909:Adamts20	APN	15	94379813	missense	probably damaging	1.00
IGL01101:Adamts20	APN	15	94344042	missense	probably damaging	1.00
IGL01137:Adamts20	APN	15	94394611	critical splice donor site	probably null
IGL01457:Adamts20	APN	15	94331448	missense	probably damaging	0.97
IGL01685:Adamts20	APN	15	94403446	missense	possibly damaging	0.81
IGL01949:Adamts20	APN	15	94326106	missense	probably benign	0.08
IGL02525:Adamts20	APN	15	94283078	splice site	probably null
IGL03088:Adamts20	APN	15	94329914	critical splice donor site	probably null
IGL03175:Adamts20	APN	15	94273255	nonsense	probably null
belt	UTSW	15	94345990	missense	probably damaging	1.00
buckeye	UTSW	15	94341087	missense	probably damaging	1.00
jack_white	UTSW	15		unclassified
meowth	UTSW	15	94331458	missense	probably damaging	1.00
nidoking	UTSW	15	94403445	missense	probably damaging	1.00
panda	UTSW	15	94326699	intron	probably benign
pikachu	UTSW	15	94345990	missense	probably damaging	1.00
poliwag	UTSW	15	94394622	nonsense	probably null
splotch2	UTSW	15	94335561	intron	probably benign
wash	UTSW	15	94347670	nonsense	probably null
whitebelly	UTSW	15		unclassified
whopper	UTSW	15	94347810	missense	probably damaging	1.00
R0483:Adamts20	UTSW	15	94353571	missense	probably benign	0.00
R0514:Adamts20	UTSW	15	94270376	missense	probably damaging	1.00
R0568:Adamts20	UTSW	15	94291713	splice site	probably benign
R0730:Adamts20	UTSW	15	94347690	missense	probably benign	0.00
R0973:Adamts20	UTSW	15	94286371	missense	probably benign	0.00
R1339:Adamts20	UTSW	15	94322896	missense	probably benign	0.19
R1721:Adamts20	UTSW	15	94338459	missense	probably benign	0.44
R1809:Adamts20	UTSW	15	94341087	missense	probably damaging	1.00
R1832:Adamts20	UTSW	15	94286344	missense	probably benign	0.00
R1846:Adamts20	UTSW	15	94345990	missense	probably damaging	1.00
R1867:Adamts20	UTSW	15	94338459	missense	probably benign	0.44
R1875:Adamts20	UTSW	15	94331396	missense	probably benign	0.01
R1930:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R1931:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R1932:Adamts20	UTSW	15	94404010	missense	probably benign	0.03
R2001:Adamts20	UTSW	15	94347718	missense	possibly damaging	0.96
R2116:Adamts20	UTSW	15	94355362	missense	probably damaging	1.00
R2162:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R2350:Adamts20	UTSW	15	94283916	missense	probably damaging	1.00
R2887:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2889:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R2890:Adamts20	UTSW	15	94330578	missense	probably benign	0.00
R3109:Adamts20	UTSW	15	94345904	splice site	probably benign
R3719:Adamts20	UTSW	15	94361838	missense	probably damaging	0.99
R3832:Adamts20	UTSW	15	94331458	missense	probably damaging	1.00
R3901:Adamts20	UTSW	15	94328845	missense	possibly damaging	0.81
R4398:Adamts20	UTSW	15	94333695	missense	possibly damaging	0.93
R4402:Adamts20	UTSW	15	94379946	missense	probably benign
R4431:Adamts20	UTSW	15	94344043	missense	probably damaging	1.00
R4479:Adamts20	UTSW	15	94403445	missense	probably damaging	1.00
R4482:Adamts20	UTSW	15	94345920	missense	probably damaging	1.00
R4503:Adamts20	UTSW	15	94379750	missense	probably damaging	0.99
R4671:Adamts20	UTSW	15	94403325	missense	possibly damaging	0.48
R4700:Adamts20	UTSW	15	94394622	nonsense	probably null
R4707:Adamts20	UTSW	15	94333647	missense	possibly damaging	0.53
R4725:Adamts20	UTSW	15	94351762	missense	probably damaging	0.99
R4771:Adamts20	UTSW	15	94351635	splice site	probably null
R4829:Adamts20	UTSW	15	94326396	missense	probably benign	0.01
R4937:Adamts20	UTSW	15	94379775	missense	probably benign
R4960:Adamts20	UTSW	15	94379774	missense	probably benign
R5270:Adamts20	UTSW	15	94282519	missense	probably benign	0.00
R5388:Adamts20	UTSW	15	94345778	missense	possibly damaging	0.81
R5453:Adamts20	UTSW	15	94326088	missense	possibly damaging	0.69
R5611:Adamts20	UTSW	15	94273280	missense	possibly damaging	0.65
R5687:Adamts20	UTSW	15	94325971	missense	probably benign	0.36
R5758:Adamts20	UTSW	15	94394650	missense	probably benign	0.00
R5801:Adamts20	UTSW	15	94347670	nonsense	probably null
R5834:Adamts20	UTSW	15	94353584	missense	probably damaging	0.99
R5993:Adamts20	UTSW	15	94338723	missense	probably damaging	0.99
R5997:Adamts20	UTSW	15	94379747	missense	probably damaging	1.00
R6044:Adamts20	UTSW	15	94282483	missense	probably damaging	1.00
R6058:Adamts20	UTSW	15	94330047	nonsense	probably null
R6217:Adamts20	UTSW	15	94338715	missense	probably benign	0.00
R6283:Adamts20	UTSW	15	94351721	missense	probably benign
R6354:Adamts20	UTSW	15	94347810	missense	probably damaging	1.00
R6415:Adamts20	UTSW	15	94324659	critical splice donor site	probably null
R6419:Adamts20	UTSW	15	94333675	missense	possibly damaging	0.84
R6476:Adamts20	UTSW	15	94361810	missense	probably benign	0.22
R6485:Adamts20	UTSW	15	94343971	missense	probably benign	0.17
R6517:Adamts20	UTSW	15	94283104	splice site	probably null
R6675:Adamts20	UTSW	15	94331316	critical splice donor site	probably null
R6863:Adamts20	UTSW	15	94379746	nonsense	probably null
R7186:Adamts20	UTSW	15	94322808	missense	possibly damaging	0.76
R7263:Adamts20	UTSW	15	94322891	missense	possibly damaging	0.52
R7441:Adamts20	UTSW	15	94353673	missense	probably damaging	1.00
R7519:Adamts20	UTSW	15	94325988	missense	possibly damaging	0.64
R7747:Adamts20	UTSW	15	94291587	nonsense	probably null
R7770:Adamts20	UTSW	15	94333698	missense	probably benign	0.02
R7816:Adamts20	UTSW	15	94322844	missense	probably benign	0.00
R7827:Adamts20	UTSW	15	94325933	missense	probably damaging	1.00
R7853:Adamts20	UTSW	15	94345990	missense	probably damaging	1.00
R7894:Adamts20	UTSW	15	94351760	missense	probably damaging	1.00
R7951:Adamts20	UTSW	15	94341066	missense	probably damaging	1.00
R8233:Adamts20	UTSW	15	94291652	missense	probably benign	0.19
R8458:Adamts20	UTSW	15	94353640	missense	probably benign	0.02
R8709:Adamts20	UTSW	15	94341066	missense	probably damaging	1.00
R8719:Adamts20	UTSW	15	94344022	missense	probably damaging	0.99
R8728:Adamts20	UTSW	15	94331400	missense	probably benign	0.00
R8787:Adamts20	UTSW	15	94286413	missense	possibly damaging	0.83
R8801:Adamts20	UTSW	15	94360609	missense	probably damaging	1.00
R9055:Adamts20	UTSW	15	94283986	missense	probably damaging	0.98
R9069:Adamts20	UTSW	15	94338468	missense	probably benign	0.00
R9297:Adamts20	UTSW	15	94403440	missense	possibly damaging	0.88
R9318:Adamts20	UTSW	15	94403440	missense	possibly damaging	0.88
R9362:Adamts20	UTSW	15	94338745	missense	possibly damaging	0.86
R9658:Adamts20	UTSW	15	94351745	missense	probably damaging	1.00
R9747:Adamts20	UTSW	15	94283062	missense	probably damaging	1.00
R9769:Adamts20	UTSW	15	94353578	missense	probably damaging	1.00
R9795:Adamts20	UTSW	15	94403299	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- AGGTCCCCATACTTCCTCAGAG -3'
(R):5'- GGAAGGACAGAAGTGTGCCTTC -3'

Sequencing Primer
(F):5'- GGAAACCATCTTGTACAACGGTTC -3'
(R):5'- GAAGTGTGCCTTCTGTTTTACC -3'

Posted On

2016-09-01