Incidental Mutation 'R5410:Lmbr1l'
ID 426527
Institutional Source Beutler Lab
Gene Symbol Lmbr1l
Ensembl Gene ENSMUSG00000022999
Gene Name limb region 1 like
Synonyms 1110013E13Rik, D15Ertd735e
MMRRC Submission 042979-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 98903917-98918231 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 98909262 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 213 (T213A)
Ref Sequence ENSEMBL: ENSMUSP00000023736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023736] [ENSMUST00000109127]
AlphaFold Q9D1E5
Predicted Effect probably damaging
Transcript: ENSMUST00000023736
AA Change: T213A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023736
Gene: ENSMUSG00000022999
AA Change: T213A

DomainStartEndE-ValueType
Pfam:LMBR1 28 269 2e-41 PFAM
Pfam:LMBR1 266 450 1.2e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109127
SMART Domains Protein: ENSMUSP00000104755
Gene: ENSMUSG00000022999

DomainStartEndE-ValueType
Pfam:LMBR1 1 324 6.3e-110 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123950
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135051
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231087
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene disruption display normal morphology, clinical chemistry, hematology, and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,126,473 noncoding transcript Het
Adam24 A G 8: 40,681,064 M524V probably benign Het
Adamts20 T A 15: 94,281,957 N1788I possibly damaging Het
Arfgef3 T G 10: 18,611,237 I1350L probably damaging Het
Arhgap17 A G 7: 123,297,493 probably null Het
Ascl5 A T 1: 136,051,188 I129F probably damaging Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bpifb9a A T 2: 154,270,235 N564Y probably benign Het
Cdon G T 9: 35,470,035 D574Y probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Ces1e T A 8: 93,210,442 I334F possibly damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Cntn3 T A 6: 102,278,353 T195S probably benign Het
Csmd2 C A 4: 128,548,819 H3221Q probably benign Het
Cyp2c68 T C 19: 39,699,284 D423G possibly damaging Het
Dennd3 C T 15: 73,547,448 T696M probably benign Het
Ep300 T C 15: 81,648,854 M1704T unknown Het
Exoc2 A G 13: 30,864,856 F738S probably damaging Het
Fis1 A G 5: 136,965,566 E36G probably damaging Het
Galnt1 A G 18: 24,267,547 I237V probably benign Het
Gspt1 A T 16: 11,230,510 I416N probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hykk G A 9: 54,946,066 C224Y probably damaging Het
Ifi211 T C 1: 173,906,263 T111A probably benign Het
Il17rd T C 14: 27,095,911 Y186H probably damaging Het
Klhl29 G T 12: 5,091,366 N539K probably benign Het
Madd C T 2: 91,154,514 R1318Q probably damaging Het
Mecom C A 3: 29,997,721 A182S probably benign Het
Olfr1305 C T 2: 111,873,292 A188T probably damaging Het
Olfr20 C T 11: 73,353,806 P18S probably benign Het
Olfr272 C A 4: 52,910,991 A268S probably benign Het
Olfr67 A T 7: 103,787,374 V301E probably damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pdia5 A G 16: 35,453,536 V130A probably damaging Het
Phldb2 T A 16: 45,825,612 H202L possibly damaging Het
Ppig G A 2: 69,735,897 G136E probably null Het
Prr14l C A 5: 32,827,777 R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 Y714C probably damaging Het
Ptprr T C 10: 116,188,330 V182A possibly damaging Het
Rai14 A G 15: 10,574,938 Y645H probably damaging Het
Rasgrp3 T C 17: 75,497,047 I115T probably benign Het
Rc3h1 G T 1: 160,964,963 R990L possibly damaging Het
Rdh5 T A 10: 128,918,291 Q21L probably benign Het
Rfx8 A G 1: 39,710,156 probably null Het
Scap A G 9: 110,374,182 probably null Het
Shank1 T A 7: 44,351,822 S988R unknown Het
Slc16a14 T A 1: 84,907,424 I465F probably damaging Het
Slc41a2 A G 10: 83,281,368 probably null Het
Tab2 T C 10: 7,919,821 H225R possibly damaging Het
Tbx19 T A 1: 165,160,372 N64I probably damaging Het
Tmprss11f A T 5: 86,530,106 I268K probably damaging Het
Tox2 A G 2: 163,320,373 M388V probably benign Het
Trbv17 T C 6: 41,163,538 L109P probably damaging Het
Trim72 A G 7: 128,009,923 H299R probably damaging Het
Vmn1r63 C T 7: 5,803,190 V148I possibly damaging Het
Zfp938 A C 10: 82,225,258 H509Q possibly damaging Het
Zfyve16 A G 13: 92,521,231 V724A probably benign Het
Zscan10 T C 17: 23,610,421 F569L probably damaging Het
Other mutations in Lmbr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02002:Lmbr1l APN 15 98904785 missense probably damaging 1.00
IGL02097:Lmbr1l APN 15 98917891 missense probably damaging 0.98
IGL02731:Lmbr1l APN 15 98917896 missense probably damaging 0.96
finch UTSW 15 98909386 critical splice donor site probably null
Gooseberry UTSW 15 98912427 missense probably damaging 0.99
junco UTSW 15 98912527 missense probably damaging 1.00
morula UTSW 15 98904791 missense probably damaging 1.00
munia UTSW 15 98909269 critical splice acceptor site probably null
strawberry UTSW 15 98909263 nonsense probably null
R0310:Lmbr1l UTSW 15 98908773 splice site probably benign
R1778:Lmbr1l UTSW 15 98912476 missense probably damaging 1.00
R2418:Lmbr1l UTSW 15 98907537 missense possibly damaging 0.89
R2419:Lmbr1l UTSW 15 98907537 missense possibly damaging 0.89
R4181:Lmbr1l UTSW 15 98908720 missense possibly damaging 0.94
R4379:Lmbr1l UTSW 15 98909263 nonsense probably null
R4472:Lmbr1l UTSW 15 98906297 missense probably benign 0.02
R5290:Lmbr1l UTSW 15 98912242 missense probably damaging 1.00
R5436:Lmbr1l UTSW 15 98904791 missense probably damaging 1.00
R5667:Lmbr1l UTSW 15 98907608 missense possibly damaging 0.88
R5671:Lmbr1l UTSW 15 98907608 missense possibly damaging 0.88
R5918:Lmbr1l UTSW 15 98912427 missense probably damaging 0.99
R6735:Lmbr1l UTSW 15 98909240 missense probably damaging 1.00
R6882:Lmbr1l UTSW 15 98907586 missense probably damaging 0.99
R7131:Lmbr1l UTSW 15 98906323 missense probably benign 0.05
R7136:Lmbr1l UTSW 15 98911491 splice site probably null
R7169:Lmbr1l UTSW 15 98909158 frame shift probably null
R7169:Lmbr1l UTSW 15 98909194 critical splice donor site probably benign
R7336:Lmbr1l UTSW 15 98913587 missense possibly damaging 0.94
R7541:Lmbr1l UTSW 15 98909386 critical splice donor site probably null
R7603:Lmbr1l UTSW 15 98908691 nonsense probably null
R7974:Lmbr1l UTSW 15 98911619 missense probably benign 0.03
R8354:Lmbr1l UTSW 15 98912476 missense probably damaging 1.00
R8454:Lmbr1l UTSW 15 98912476 missense probably damaging 1.00
R8504:Lmbr1l UTSW 15 98912184 missense probably damaging 0.97
R8933:Lmbr1l UTSW 15 98909269 critical splice acceptor site probably null
R8974:Lmbr1l UTSW 15 98912527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTGTTCTGACCAACTCCAG -3'
(R):5'- GCAAGACAAGTTGACATGGC -3'

Sequencing Primer
(F):5'- GTGTTCTGACCAACTCCAGATGATG -3'
(R):5'- AGACTTCTGGGAGTACTACCTC -3'
Posted On 2016-09-01