Incidental Mutation 'R5410:Galnt1'
ID426533
Institutional Source Beutler Lab
Gene Symbol Galnt1
Ensembl Gene ENSMUSG00000000420
Gene Namepolypeptide N-acetylgalactosaminyltransferase 1
SynonymsppGaNTase-T1
MMRRC Submission 042979-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R5410 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location24205344-24286818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24267547 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 237 (I237V)
Ref Sequence ENSEMBL: ENSMUSP00000137427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000430] [ENSMUST00000170243] [ENSMUST00000171583] [ENSMUST00000178605]
Predicted Effect probably benign
Transcript: ENSMUST00000000430
AA Change: I237V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000000430
Gene: ENSMUSG00000000420
AA Change: I237V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 3.2e-11 PFAM
Pfam:Glycos_transf_2 119 303 3.1e-40 PFAM
Pfam:Glyco_transf_7C 281 349 9.1e-10 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164066
SMART Domains Protein: ENSMUSP00000130238
Gene: ENSMUSG00000000420

DomainStartEndE-ValueType
PDB:2D7R|A 2 44 6e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000170243
AA Change: I237V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132142
Gene: ENSMUSG00000000420
AA Change: I237V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171583
SMART Domains Protein: ENSMUSP00000131755
Gene: ENSMUSG00000000420

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178605
AA Change: I237V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137427
Gene: ENSMUSG00000000420
AA Change: I237V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. Transcript variants derived from this gene that utilize alternative polyA signals have been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, increased bleeding time, decreased T and B cells, impaired leukocyte rolling, decreased IgG levels, and hypoalbuminemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,126,473 noncoding transcript Het
Adam24 A G 8: 40,681,064 M524V probably benign Het
Adamts20 T A 15: 94,281,957 N1788I possibly damaging Het
Arfgef3 T G 10: 18,611,237 I1350L probably damaging Het
Arhgap17 A G 7: 123,297,493 probably null Het
Ascl5 A T 1: 136,051,188 I129F probably damaging Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bpifb9a A T 2: 154,270,235 N564Y probably benign Het
Cdon G T 9: 35,470,035 D574Y probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Ces1e T A 8: 93,210,442 I334F possibly damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Cntn3 T A 6: 102,278,353 T195S probably benign Het
Csmd2 C A 4: 128,548,819 H3221Q probably benign Het
Cyp2c68 T C 19: 39,699,284 D423G possibly damaging Het
Dennd3 C T 15: 73,547,448 T696M probably benign Het
Ep300 T C 15: 81,648,854 M1704T unknown Het
Exoc2 A G 13: 30,864,856 F738S probably damaging Het
Fis1 A G 5: 136,965,566 E36G probably damaging Het
Gspt1 A T 16: 11,230,510 I416N probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hykk G A 9: 54,946,066 C224Y probably damaging Het
Ifi211 T C 1: 173,906,263 T111A probably benign Het
Il17rd T C 14: 27,095,911 Y186H probably damaging Het
Klhl29 G T 12: 5,091,366 N539K probably benign Het
Lmbr1l T C 15: 98,909,262 T213A probably damaging Het
Madd C T 2: 91,154,514 R1318Q probably damaging Het
Mecom C A 3: 29,997,721 A182S probably benign Het
Olfr1305 C T 2: 111,873,292 A188T probably damaging Het
Olfr20 C T 11: 73,353,806 P18S probably benign Het
Olfr272 C A 4: 52,910,991 A268S probably benign Het
Olfr67 A T 7: 103,787,374 V301E probably damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pdia5 A G 16: 35,453,536 V130A probably damaging Het
Phldb2 T A 16: 45,825,612 H202L possibly damaging Het
Ppig G A 2: 69,735,897 G136E probably null Het
Prr14l C A 5: 32,827,777 R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 Y714C probably damaging Het
Ptprr T C 10: 116,188,330 V182A possibly damaging Het
Rai14 A G 15: 10,574,938 Y645H probably damaging Het
Rasgrp3 T C 17: 75,497,047 I115T probably benign Het
Rc3h1 G T 1: 160,964,963 R990L possibly damaging Het
Rdh5 T A 10: 128,918,291 Q21L probably benign Het
Rfx8 A G 1: 39,710,156 probably null Het
Scap A G 9: 110,374,182 probably null Het
Shank1 T A 7: 44,351,822 S988R unknown Het
Slc16a14 T A 1: 84,907,424 I465F probably damaging Het
Slc41a2 A G 10: 83,281,368 probably null Het
Tab2 T C 10: 7,919,821 H225R possibly damaging Het
Tbx19 T A 1: 165,160,372 N64I probably damaging Het
Tmprss11f A T 5: 86,530,106 I268K probably damaging Het
Tox2 A G 2: 163,320,373 M388V probably benign Het
Trbv17 T C 6: 41,163,538 L109P probably damaging Het
Trim72 A G 7: 128,009,923 H299R probably damaging Het
Vmn1r63 C T 7: 5,803,190 V148I possibly damaging Het
Zfp938 A C 10: 82,225,258 H509Q possibly damaging Het
Zfyve16 A G 13: 92,521,231 V724A probably benign Het
Zscan10 T C 17: 23,610,421 F569L probably damaging Het
Other mutations in Galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Galnt1 APN 18 24267560 missense probably damaging 1.00
IGL02373:Galnt1 APN 18 24280035 missense possibly damaging 0.68
IGL02998:Galnt1 APN 18 24264412 missense probably damaging 1.00
IGL03080:Galnt1 APN 18 24269517 missense probably damaging 0.99
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0234:Galnt1 UTSW 18 24254633 missense probably damaging 1.00
R0463:Galnt1 UTSW 18 24254525 missense probably benign 0.01
R1183:Galnt1 UTSW 18 24271590 missense probably damaging 1.00
R1954:Galnt1 UTSW 18 24271774 splice site probably benign
R2349:Galnt1 UTSW 18 24280028 missense probably benign 0.03
R3739:Galnt1 UTSW 18 24271655 missense probably benign 0.27
R4223:Galnt1 UTSW 18 24238356 missense probably benign 0.27
R5001:Galnt1 UTSW 18 24271755 missense probably benign
R5516:Galnt1 UTSW 18 24280017 missense probably benign 0.00
R5685:Galnt1 UTSW 18 24264529 missense possibly damaging 0.81
R5687:Galnt1 UTSW 18 24272750 missense probably benign 0.00
R5735:Galnt1 UTSW 18 24264520 missense possibly damaging 0.64
R6106:Galnt1 UTSW 18 24254663 missense probably benign 0.31
R6222:Galnt1 UTSW 18 24264534 critical splice donor site probably null
R7448:Galnt1 UTSW 18 24284809 missense probably benign 0.00
R7489:Galnt1 UTSW 18 24282157 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGATTATATGCTTACTTCCCCAC -3'
(R):5'- GAAAACGTCTGACAAATTACCTGAC -3'

Sequencing Primer
(F):5'- GCCTAAAAAGGATTGTGTACCAC -3'
(R):5'- CGTCTGACAAATTACCTGACAGGAAG -3'
Posted On2016-09-01