Incidental Mutation 'R5410:Galnt1'
ID 426533
Institutional Source Beutler Lab
Gene Symbol Galnt1
Ensembl Gene ENSMUSG00000000420
Gene Name polypeptide N-acetylgalactosaminyltransferase 1
Synonyms ppGaNTase-T1
MMRRC Submission 042979-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.911) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 24338401-24419873 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24400604 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 237 (I237V)
Ref Sequence ENSEMBL: ENSMUSP00000137427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000430] [ENSMUST00000170243] [ENSMUST00000171583] [ENSMUST00000178605]
AlphaFold O08912
Predicted Effect probably benign
Transcript: ENSMUST00000000430
AA Change: I237V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000000430
Gene: ENSMUSG00000000420
AA Change: I237V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 3.2e-11 PFAM
Pfam:Glycos_transf_2 119 303 3.1e-40 PFAM
Pfam:Glyco_transf_7C 281 349 9.1e-10 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164066
SMART Domains Protein: ENSMUSP00000130238
Gene: ENSMUSG00000000420

DomainStartEndE-ValueType
PDB:2D7R|A 2 44 6e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000170243
AA Change: I237V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000132142
Gene: ENSMUSG00000000420
AA Change: I237V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171583
SMART Domains Protein: ENSMUSP00000131755
Gene: ENSMUSG00000000420

DomainStartEndE-ValueType
transmembrane domain 10 29 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178605
AA Change: I237V

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000137427
Gene: ENSMUSG00000000420
AA Change: I237V

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 116 369 1.7e-12 PFAM
Pfam:Glycos_transf_2 119 303 9.2e-37 PFAM
Pfam:Glyco_tranf_2_2 119 344 7.1e-7 PFAM
Pfam:Glyco_transf_7C 281 349 1.4e-8 PFAM
RICIN 426 551 1.25e-32 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase (GalNAc-T) family of enzymes. GalNAc-Ts initiate mucin-type O-linked glycosylation in the Golgi apparatus by catalyzing the transfer of GalNAc to serine and threonine residues on target proteins. They are characterized by an N-terminal transmembrane domain, a stem region, a lumenal catalytic domain containing a GT1 motif and Gal/GalNAc transferase motif, and a C-terminal ricin/lectin-like domain. GalNAc-Ts have different, but overlapping, substrate specificities and patterns of expression. Transcript variants derived from this gene that utilize alternative polyA signals have been described in the literature. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit some embryonic lethality, increased bleeding time, decreased T and B cells, impaired leukocyte rolling, decreased IgG levels, and hypoalbuminemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 41,134,103 (GRCm39) M524V probably benign Het
Adamts20 T A 15: 94,179,838 (GRCm39) N1788I possibly damaging Het
Arfgef3 T G 10: 18,486,985 (GRCm39) I1350L probably damaging Het
Arhgap17 A G 7: 122,896,716 (GRCm39) probably null Het
Ascl5 A T 1: 135,978,926 (GRCm39) I129F probably damaging Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bpifb9a A T 2: 154,112,155 (GRCm39) N564Y probably benign Het
Cdon G T 9: 35,381,331 (GRCm39) D574Y probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Ces1e T A 8: 93,937,070 (GRCm39) I334F possibly damaging Het
Clip2 G A 5: 134,551,645 (GRCm39) T159M possibly damaging Het
Cntn3 T A 6: 102,255,314 (GRCm39) T195S probably benign Het
Csmd2 C A 4: 128,442,612 (GRCm39) H3221Q probably benign Het
Cyp2c68 T C 19: 39,687,728 (GRCm39) D423G possibly damaging Het
Dennd3 C T 15: 73,419,297 (GRCm39) T696M probably benign Het
Ep300 T C 15: 81,533,055 (GRCm39) M1704T unknown Het
Exoc2 A G 13: 31,048,839 (GRCm39) F738S probably damaging Het
Fis1 A G 5: 136,994,420 (GRCm39) E36G probably damaging Het
Gspt1 A T 16: 11,048,374 (GRCm39) I416N probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hykk G A 9: 54,853,350 (GRCm39) C224Y probably damaging Het
Ifi211 T C 1: 173,733,829 (GRCm39) T111A probably benign Het
Il17rd T C 14: 26,817,868 (GRCm39) Y186H probably damaging Het
Klhl29 G T 12: 5,141,366 (GRCm39) N539K probably benign Het
Lmbr1l T C 15: 98,807,143 (GRCm39) T213A probably damaging Het
Madd C T 2: 90,984,859 (GRCm39) R1318Q probably damaging Het
Mecom C A 3: 30,051,870 (GRCm39) A182S probably benign Het
Or13c25 C A 4: 52,910,991 (GRCm39) A268S probably benign Het
Or1e1 C T 11: 73,244,632 (GRCm39) P18S probably benign Het
Or4f56 C T 2: 111,703,637 (GRCm39) A188T probably damaging Het
Or52z1 A T 7: 103,436,581 (GRCm39) V301E probably damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
Pdia5 A G 16: 35,273,906 (GRCm39) V130A probably damaging Het
Phldb2 T A 16: 45,645,975 (GRCm39) H202L possibly damaging Het
Ppig G A 2: 69,566,241 (GRCm39) G136E probably null Het
Prr14l C A 5: 32,985,121 (GRCm39) R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 (GRCm39) Y714C probably damaging Het
Ptprr T C 10: 116,024,235 (GRCm39) V182A possibly damaging Het
Rai14 A G 15: 10,575,024 (GRCm39) Y645H probably damaging Het
Rasgrp3 T C 17: 75,804,042 (GRCm39) I115T probably benign Het
Rc3h1 G T 1: 160,792,533 (GRCm39) R990L possibly damaging Het
Rdh5 T A 10: 128,754,160 (GRCm39) Q21L probably benign Het
Rfx8 A G 1: 39,749,316 (GRCm39) probably null Het
Scap A G 9: 110,203,250 (GRCm39) probably null Het
Shank1 T A 7: 44,001,246 (GRCm39) S988R unknown Het
Slc16a14 T A 1: 84,885,145 (GRCm39) I465F probably damaging Het
Slc41a2 A G 10: 83,117,232 (GRCm39) probably null Het
Tab2 T C 10: 7,795,585 (GRCm39) H225R possibly damaging Het
Tbx19 T A 1: 164,987,941 (GRCm39) N64I probably damaging Het
Tmprss11f A T 5: 86,677,965 (GRCm39) I268K probably damaging Het
Tox2 A G 2: 163,162,293 (GRCm39) M388V probably benign Het
Trbv17 T C 6: 41,140,472 (GRCm39) L109P probably damaging Het
Trim72 A G 7: 127,609,095 (GRCm39) H299R probably damaging Het
Ulbp3 G A 10: 3,076,473 (GRCm39) noncoding transcript Het
Vmn1r63 C T 7: 5,806,189 (GRCm39) V148I possibly damaging Het
Zfp938 A C 10: 82,061,092 (GRCm39) H509Q possibly damaging Het
Zfyve16 A G 13: 92,657,739 (GRCm39) V724A probably benign Het
Zscan10 T C 17: 23,829,395 (GRCm39) F569L probably damaging Het
Other mutations in Galnt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01833:Galnt1 APN 18 24,400,617 (GRCm39) missense probably damaging 1.00
IGL02373:Galnt1 APN 18 24,413,092 (GRCm39) missense possibly damaging 0.68
IGL02998:Galnt1 APN 18 24,397,469 (GRCm39) missense probably damaging 1.00
IGL03080:Galnt1 APN 18 24,402,574 (GRCm39) missense probably damaging 0.99
debonair UTSW 18 24,404,686 (GRCm39) missense probably damaging 1.00
R0234:Galnt1 UTSW 18 24,387,690 (GRCm39) missense probably damaging 1.00
R0234:Galnt1 UTSW 18 24,387,690 (GRCm39) missense probably damaging 1.00
R0463:Galnt1 UTSW 18 24,387,582 (GRCm39) missense probably benign 0.01
R1183:Galnt1 UTSW 18 24,404,647 (GRCm39) missense probably damaging 1.00
R1954:Galnt1 UTSW 18 24,404,831 (GRCm39) splice site probably benign
R2349:Galnt1 UTSW 18 24,413,085 (GRCm39) missense probably benign 0.03
R3739:Galnt1 UTSW 18 24,404,712 (GRCm39) missense probably benign 0.27
R4223:Galnt1 UTSW 18 24,371,413 (GRCm39) missense probably benign 0.27
R5001:Galnt1 UTSW 18 24,404,812 (GRCm39) missense probably benign
R5516:Galnt1 UTSW 18 24,413,074 (GRCm39) missense probably benign 0.00
R5685:Galnt1 UTSW 18 24,397,586 (GRCm39) missense possibly damaging 0.81
R5687:Galnt1 UTSW 18 24,405,807 (GRCm39) missense probably benign 0.00
R5735:Galnt1 UTSW 18 24,397,577 (GRCm39) missense possibly damaging 0.64
R6106:Galnt1 UTSW 18 24,387,720 (GRCm39) missense probably benign 0.31
R6222:Galnt1 UTSW 18 24,397,591 (GRCm39) critical splice donor site probably null
R7448:Galnt1 UTSW 18 24,417,866 (GRCm39) missense probably benign 0.00
R7489:Galnt1 UTSW 18 24,415,214 (GRCm39) missense probably damaging 0.98
R8310:Galnt1 UTSW 18 24,404,686 (GRCm39) missense probably damaging 1.00
R8408:Galnt1 UTSW 18 24,400,628 (GRCm39) missense probably benign 0.44
R8884:Galnt1 UTSW 18 24,400,641 (GRCm39) missense probably benign 0.00
R8989:Galnt1 UTSW 18 24,402,567 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GCAGATTATATGCTTACTTCCCCAC -3'
(R):5'- GAAAACGTCTGACAAATTACCTGAC -3'

Sequencing Primer
(F):5'- GCCTAAAAAGGATTGTGTACCAC -3'
(R):5'- CGTCTGACAAATTACCTGACAGGAAG -3'
Posted On 2016-09-01