Incidental Mutation 'R5421:Bmpr2'
ID426535
Institutional Source Beutler Lab
Gene Symbol Bmpr2
Ensembl Gene ENSMUSG00000067336
Gene Namebone morphogenetic protein receptor, type II (serine/threonine kinase)
Synonyms2610024H22Rik, BMPRII, BMPR-II, BMP-2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location59763400-59879014 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 59870418 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1017 (V1017E)
Ref Sequence ENSEMBL: ENSMUSP00000084701 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087435]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087435
AA Change: V1017E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000084701
Gene: ENSMUSG00000067336
AA Change: V1017E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Activin_recp 33 131 6.9e-17 PFAM
low complexity region 132 142 N/A INTRINSIC
transmembrane domain 152 174 N/A INTRINSIC
Pfam:Pkinase 203 501 6.6e-33 PFAM
Pfam:Pkinase_Tyr 203 501 1.3e-29 PFAM
low complexity region 545 558 N/A INTRINSIC
low complexity region 603 628 N/A INTRINSIC
low complexity region 694 710 N/A INTRINSIC
low complexity region 901 908 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine/threonine kinase that functions as a receptor for bone morphogenetic proteins (BMPs). The encoded protein is a type II receptor that binds extracellular BMPs and forms a complex of two type II and two type I receptors at the cell membrane. This complex signals downstream to activate SMAD transcriptional regulators. This signaling is important during embryonic development. Mutations in this gene can cause pulmonary hypertension. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous null mutants arrest at the egg cylinder stage and die before embryonic day 9.5 with failure to form organized structure and lacking mesoderm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Bmpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Bmpr2 APN 1 59815315 missense possibly damaging 0.88
IGL01366:Bmpr2 APN 1 59813677 missense probably damaging 1.00
IGL02281:Bmpr2 APN 1 59868344 missense probably damaging 1.00
IGL02531:Bmpr2 APN 1 59845714 splice site probably null
IGL03114:Bmpr2 APN 1 59867444 missense probably damaging 1.00
R0114:Bmpr2 UTSW 1 59815340 missense probably damaging 1.00
R0145:Bmpr2 UTSW 1 59867580 frame shift probably null
R0423:Bmpr2 UTSW 1 59868510 missense probably benign
R0480:Bmpr2 UTSW 1 59845659 missense probably damaging 1.00
R0556:Bmpr2 UTSW 1 59815328 missense probably damaging 1.00
R0597:Bmpr2 UTSW 1 59841425 splice site probably benign
R1167:Bmpr2 UTSW 1 59859304 missense probably damaging 1.00
R1537:Bmpr2 UTSW 1 59868126 missense probably benign 0.31
R1769:Bmpr2 UTSW 1 59868361 missense probably damaging 1.00
R1946:Bmpr2 UTSW 1 59868397 missense possibly damaging 0.83
R1972:Bmpr2 UTSW 1 59813603 missense possibly damaging 0.55
R4524:Bmpr2 UTSW 1 59867412 missense probably benign 0.00
R4558:Bmpr2 UTSW 1 59845692 missense probably damaging 0.99
R4667:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4668:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4669:Bmpr2 UTSW 1 59867716 missense probably damaging 1.00
R4868:Bmpr2 UTSW 1 59870456 missense probably benign 0.03
R4922:Bmpr2 UTSW 1 59867424 missense probably benign
R5015:Bmpr2 UTSW 1 59851224 missense probably damaging 1.00
R5808:Bmpr2 UTSW 1 59867401 missense probably benign 0.09
R6057:Bmpr2 UTSW 1 59842818 missense probably benign 0.00
R6228:Bmpr2 UTSW 1 59867436 missense probably benign 0.11
R6449:Bmpr2 UTSW 1 59867437 missense probably damaging 0.99
R6475:Bmpr2 UTSW 1 59868344 missense probably damaging 1.00
R6754:Bmpr2 UTSW 1 59870280 missense probably damaging 1.00
R7080:Bmpr2 UTSW 1 59867683 missense probably benign 0.00
R7410:Bmpr2 UTSW 1 59868493 missense probably benign
R7425:Bmpr2 UTSW 1 59867351 missense probably benign 0.12
R8027:Bmpr2 UTSW 1 59867803 missense probably damaging 1.00
R8032:Bmpr2 UTSW 1 59867343 missense probably benign 0.03
R8117:Bmpr2 UTSW 1 59847093 missense probably damaging 0.99
R8142:Bmpr2 UTSW 1 59870306 missense probably damaging 1.00
R8166:Bmpr2 UTSW 1 59867581 missense probably damaging 0.98
R8376:Bmpr2 UTSW 1 59867356 missense probably damaging 0.99
R8419:Bmpr2 UTSW 1 59867356 missense probably damaging 0.99
R8770:Bmpr2 UTSW 1 59845525 missense probably benign 0.00
R8949:Bmpr2 UTSW 1 59867701 missense possibly damaging 0.52
Z1176:Bmpr2 UTSW 1 59847167 missense not run
Z1177:Bmpr2 UTSW 1 59847167 missense not run
Predicted Primers PCR Primer
(F):5'- CACAAGATGGCAAATCAGGATC -3'
(R):5'- TGAGACCACTTTTGATAAGCACAC -3'

Sequencing Primer
(F):5'- TGGCAAATCAGGATCAGGTG -3'
(R):5'- GCTTGAAAACATCTCACAG -3'
Posted On2016-09-01