Incidental Mutation 'R5421:Asxl1'
ID 426546
Institutional Source Beutler Lab
Gene Symbol Asxl1
Ensembl Gene ENSMUSG00000042548
Gene Name additional sex combs like 1
Synonyms
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5421 (G1)
Quality Score 224
Status Not validated
Chromosome 2
Chromosomal Location 153345829-153404007 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 153399584 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 685 (S685P)
Ref Sequence ENSEMBL: ENSMUSP00000154224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109790] [ENSMUST00000227428]
AlphaFold P59598
Predicted Effect probably benign
Transcript: ENSMUST00000109790
AA Change: S686P

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000105413
Gene: ENSMUSG00000042548
AA Change: S686P

DomainStartEndE-ValueType
Pfam:HARE-HTH 11 83 1.6e-20 PFAM
low complexity region 199 209 N/A INTRINSIC
Pfam:ASXH 236 361 5.9e-40 PFAM
low complexity region 411 422 N/A INTRINSIC
low complexity region 639 667 N/A INTRINSIC
low complexity region 705 716 N/A INTRINSIC
low complexity region 848 860 N/A INTRINSIC
low complexity region 986 1000 N/A INTRINSIC
Pfam:PHD_3 1446 1512 6.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138571
Predicted Effect probably benign
Transcript: ENSMUST00000227428
AA Change: S685P

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to the Drosophila additional sex combs gene, which encodes a chromatin-binding protein required for normal determination of segment identity in the developing embryo. The protein is a member of the Polycomb group of proteins, which are necessary for the maintenance of stable repression of homeotic and other loci. The protein is thought to disrupt chromatin in localized areas, enhancing transcription of certain genes while repressing the transcription of other genes. The protein encoded by this gene functions as a ligand-dependent co-activator for retinoic acid receptor in cooperation with nuclear receptor coactivator 1. Mutations in this gene are associated with myelodysplastic syndromes and chronic myelomonocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2009]
PHENOTYPE: Disruption of this gene causes alterations in lymphocyte development in adult mice. Mice homozygous for a different knock-out allele exhibit complete lethality. Mice heterozygous for this allele exhibit eye opacity and abnormal vertebrae morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 (GRCm38) Q882L probably damaging Het
Afdn T C 17: 13,832,406 (GRCm38) V525A probably benign Het
AI987944 T C 7: 41,374,776 (GRCm38) T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 (GRCm38) S31G probably damaging Het
Blnk C A 19: 40,968,523 (GRCm38) V47F probably damaging Het
Bmp4 T A 14: 46,385,898 (GRCm38) M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 (GRCm38) V1017E possibly damaging Het
C1ra C T 6: 124,522,790 (GRCm38) P645L probably benign Het
Cadm2 A T 16: 66,771,627 (GRCm38) C248* probably null Het
Cdk6 T C 5: 3,473,120 (GRCm38) V180A probably damaging Het
Colec12 A T 18: 9,858,580 (GRCm38) R454S probably damaging Het
Dennd3 T C 15: 73,567,115 (GRCm38) S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 (GRCm38) probably null Het
Dnah2 G A 11: 69,435,636 (GRCm38) T3613I probably damaging Het
Elp6 A G 9: 110,314,064 (GRCm38) Q115R probably benign Het
Enpp1 A G 10: 24,669,757 (GRCm38) Y262H probably damaging Het
Far2 A G 6: 148,146,192 (GRCm38) probably null Het
Flnb C T 14: 7,926,494 (GRCm38) T1846I probably damaging Het
Folr2 C T 7: 101,840,644 (GRCm38) R139H probably benign Het
Fxn A T 19: 24,277,285 (GRCm38) probably null Het
Galnt13 A C 2: 54,857,896 (GRCm38) N263T probably damaging Het
Gje1 G A 10: 14,716,684 (GRCm38) S118L probably damaging Het
Htr5a G T 5: 27,850,987 (GRCm38) W325C possibly damaging Het
Itga4 T A 2: 79,316,041 (GRCm38) Y772* probably null Het
Kif12 T C 4: 63,171,428 (GRCm38) S59G probably benign Het
Kifc3 C T 8: 95,109,845 (GRCm38) R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 (GRCm38) Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 (GRCm38) probably null Het
Nek1 A C 8: 61,006,677 (GRCm38) R6S possibly damaging Het
Or4b13 G A 2: 90,252,745 (GRCm38) T81I probably benign Het
Or5p68 G C 7: 108,346,975 (GRCm38) A2G probably benign Het
Or6k8-ps1 C T 1: 174,152,295 (GRCm38) R260* probably null Het
Palld C T 8: 61,516,550 (GRCm38) E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 (GRCm38) Y169N probably benign Het
Rad50 T C 11: 53,674,946 (GRCm38) D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 (GRCm38) K915* probably null Het
Rasal2 T C 1: 157,299,141 (GRCm38) K109R probably benign Het
Rc3h1 G A 1: 160,951,830 (GRCm38) probably null Het
Rnf6 C T 5: 146,210,529 (GRCm38) V560I probably benign Het
Samd8 A G 14: 21,792,495 (GRCm38) D295G probably damaging Het
Scart1 T C 7: 140,223,900 (GRCm38) L337P probably damaging Het
Serpinb2 T C 1: 107,523,851 (GRCm38) Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 (GRCm38) R265L probably benign Het
Slc28a3 A T 13: 58,574,265 (GRCm38) F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 (GRCm38) T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 (GRCm38) T52S possibly damaging Het
Spta1 A G 1: 174,215,529 (GRCm38) N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 (GRCm38) noncoding transcript Het
Syt9 T C 7: 107,425,356 (GRCm38) V152A probably benign Het
Thoc2l A T 5: 104,518,395 (GRCm38) N261I probably benign Het
Tln1 G A 4: 43,533,609 (GRCm38) A2315V possibly damaging Het
Tox C A 4: 6,842,409 (GRCm38) M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 (GRCm38) A37T probably benign Het
Vapa A G 17: 65,595,036 (GRCm38) V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 (GRCm38) L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 (GRCm38) A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 (GRCm38) T604A probably benign Het
Vps51 T G 19: 6,071,033 (GRCm38) E283D probably benign Het
Wnk1 A G 6: 119,952,818 (GRCm38) V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 (GRCm38) D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 (GRCm38) E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 (GRCm38) A309V probably damaging Het
Zfp626 T A 7: 27,817,910 (GRCm38) N105K probably damaging Het
Other mutations in Asxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Asxl1 APN 2 153,392,940 (GRCm38) splice site probably benign
IGL01432:Asxl1 APN 2 153,400,205 (GRCm38) missense probably benign 0.38
IGL01543:Asxl1 APN 2 153,401,484 (GRCm38) missense probably benign 0.11
IGL02355:Asxl1 APN 2 153,401,786 (GRCm38) missense probably benign 0.34
IGL02362:Asxl1 APN 2 153,401,786 (GRCm38) missense probably benign 0.34
IGL02645:Asxl1 APN 2 153,392,857 (GRCm38) missense possibly damaging 0.94
IGL02696:Asxl1 APN 2 153,400,195 (GRCm38) nonsense probably null
IGL03365:Asxl1 APN 2 153,401,754 (GRCm38) missense probably damaging 1.00
IGL03372:Asxl1 APN 2 153,400,413 (GRCm38) missense probably damaging 0.99
IGL03377:Asxl1 APN 2 153,396,780 (GRCm38) missense probably damaging 1.00
astrophel UTSW 2 153,400,106 (GRCm38) missense possibly damaging 0.75
hairbrush UTSW 2 153,400,724 (GRCm38) missense possibly damaging 0.55
R0044:Asxl1 UTSW 2 153,400,209 (GRCm38) missense probably benign 0.06
R0044:Asxl1 UTSW 2 153,400,209 (GRCm38) missense probably benign 0.06
R0600:Asxl1 UTSW 2 153,399,904 (GRCm38) missense probably benign 0.00
R0659:Asxl1 UTSW 2 153,400,724 (GRCm38) missense possibly damaging 0.55
R0661:Asxl1 UTSW 2 153,400,724 (GRCm38) missense possibly damaging 0.55
R0684:Asxl1 UTSW 2 153,397,522 (GRCm38) missense probably damaging 1.00
R1606:Asxl1 UTSW 2 153,400,455 (GRCm38) missense probably damaging 0.99
R1747:Asxl1 UTSW 2 153,393,454 (GRCm38) missense possibly damaging 0.86
R1796:Asxl1 UTSW 2 153,401,606 (GRCm38) missense probably benign 0.31
R1914:Asxl1 UTSW 2 153,401,906 (GRCm38) missense probably damaging 1.00
R2099:Asxl1 UTSW 2 153,352,267 (GRCm38) missense possibly damaging 0.95
R2373:Asxl1 UTSW 2 153,401,900 (GRCm38) missense probably benign 0.13
R2910:Asxl1 UTSW 2 153,401,039 (GRCm38) missense probably benign 0.00
R3620:Asxl1 UTSW 2 153,357,155 (GRCm38) missense probably damaging 1.00
R3701:Asxl1 UTSW 2 153,399,344 (GRCm38) missense probably benign 0.04
R4200:Asxl1 UTSW 2 153,400,106 (GRCm38) missense possibly damaging 0.75
R4773:Asxl1 UTSW 2 153,401,985 (GRCm38) missense probably damaging 1.00
R4902:Asxl1 UTSW 2 153,399,831 (GRCm38) missense probably benign 0.02
R5100:Asxl1 UTSW 2 153,397,931 (GRCm38) missense probably damaging 1.00
R5102:Asxl1 UTSW 2 153,400,955 (GRCm38) missense probably benign 0.00
R5166:Asxl1 UTSW 2 153,401,121 (GRCm38) missense probably damaging 1.00
R5701:Asxl1 UTSW 2 153,399,489 (GRCm38) missense probably damaging 1.00
R5861:Asxl1 UTSW 2 153,399,390 (GRCm38) missense probably damaging 0.99
R5973:Asxl1 UTSW 2 153,402,011 (GRCm38) missense probably damaging 0.97
R6384:Asxl1 UTSW 2 153,391,824 (GRCm38) critical splice donor site probably null
R7023:Asxl1 UTSW 2 153,400,549 (GRCm38) missense probably benign 0.00
R7028:Asxl1 UTSW 2 153,400,107 (GRCm38) missense probably benign 0.00
R7176:Asxl1 UTSW 2 153,401,988 (GRCm38) missense probably damaging 1.00
R7297:Asxl1 UTSW 2 153,397,435 (GRCm38) missense probably benign 0.01
R7378:Asxl1 UTSW 2 153,401,993 (GRCm38) missense probably damaging 1.00
R7464:Asxl1 UTSW 2 153,397,785 (GRCm38) missense probably benign 0.01
R7678:Asxl1 UTSW 2 153,400,652 (GRCm38) missense probably damaging 1.00
R7686:Asxl1 UTSW 2 153,391,614 (GRCm38) missense probably damaging 1.00
R7789:Asxl1 UTSW 2 153,400,023 (GRCm38) missense probably benign 0.00
R7838:Asxl1 UTSW 2 153,396,813 (GRCm38) missense probably damaging 1.00
R7898:Asxl1 UTSW 2 153,399,934 (GRCm38) missense possibly damaging 0.65
R8281:Asxl1 UTSW 2 153,399,401 (GRCm38) missense probably damaging 1.00
R8354:Asxl1 UTSW 2 153,393,425 (GRCm38) missense probably benign 0.40
R8383:Asxl1 UTSW 2 153,393,719 (GRCm38) missense probably damaging 1.00
R8995:Asxl1 UTSW 2 153,393,966 (GRCm38) missense probably damaging 1.00
R9183:Asxl1 UTSW 2 153,397,920 (GRCm38) missense probably damaging 0.99
X0024:Asxl1 UTSW 2 153,401,985 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACCCTCGCAGACATTAAAGC -3'
(R):5'- TCTTCCAGCCCACTTGTAAG -3'

Sequencing Primer
(F):5'- CGAGAGGTTACCACTGCAATCG -3'
(R):5'- TTGTAAGCACACCTGGGAC -3'
Posted On 2016-09-01