Incidental Mutation 'R5421:Tox'
ID426551
Institutional Source Beutler Lab
Gene Symbol Tox
Ensembl Gene ENSMUSG00000041272
Gene Namethymocyte selection-associated high mobility group box
Synonyms1700007F02Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location6686353-6991557 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 6842409 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 40 (M40I)
Ref Sequence ENSEMBL: ENSMUSP00000037966 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039987]
PDB Structure Solution structure of the HMG_box domain of thymus high mobility group box protein TOX from mouse [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039987
AA Change: M40I

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000037966
Gene: ENSMUSG00000041272
AA Change: M40I

DomainStartEndE-ValueType
low complexity region 7 19 N/A INTRINSIC
low complexity region 204 220 N/A INTRINSIC
HMG 260 330 1.11e-19 SMART
low complexity region 416 439 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147657
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150082
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a HMG box DNA binding domain. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. This protein may function to regulate T-cell development.[provided by RefSeq, Apr 2009]
PHENOTYPE: Mice homozygous for a knock-out allele have a severe block in thymic positive selection leading to loss of CD4 T lineage cells, and display decreased NK cell numbers, severely reduced numbers of lymphoid tissue inducer cells, absence of all peripheral lymph nodes, and loss of Peyer's patches. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Tox
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Tox APN 4 6697583 missense probably damaging 0.99
IGL01481:Tox APN 4 6842396 missense probably damaging 0.99
IGL01600:Tox APN 4 6697585 missense probably damaging 0.98
IGL01616:Tox APN 4 6688430 missense probably damaging 0.99
IGL02160:Tox APN 4 6711537 missense probably damaging 0.99
IGL02390:Tox APN 4 6697534 missense possibly damaging 0.90
IGL03243:Tox APN 4 6697597 missense possibly damaging 0.76
R0008:Tox UTSW 4 6842411 missense probably benign 0.41
R0008:Tox UTSW 4 6842411 missense probably benign 0.41
R1147:Tox UTSW 4 6823055 missense possibly damaging 0.74
R1147:Tox UTSW 4 6823055 missense possibly damaging 0.74
R1159:Tox UTSW 4 6697600 missense probably benign 0.37
R1903:Tox UTSW 4 6688948 missense probably damaging 0.99
R1961:Tox UTSW 4 6688886 missense probably damaging 0.96
R2484:Tox UTSW 4 6688886 missense probably damaging 0.96
R3692:Tox UTSW 4 6697535 missense probably benign 0.05
R4072:Tox UTSW 4 6842396 missense probably damaging 0.99
R4635:Tox UTSW 4 6990501 utr 5 prime probably benign
R4815:Tox UTSW 4 6823033 missense probably benign
R5099:Tox UTSW 4 6688958 missense probably benign 0.28
R5537:Tox UTSW 4 6697510 missense probably damaging 1.00
R5630:Tox UTSW 4 6688835 small insertion probably benign
R5883:Tox UTSW 4 6697444 missense probably benign
R6351:Tox UTSW 4 6697439 missense probably benign
R6351:Tox UTSW 4 6741536 missense probably benign 0.11
R6448:Tox UTSW 4 6822975 missense probably benign 0.08
R6934:Tox UTSW 4 6697635 missense probably damaging 0.98
R7513:Tox UTSW 4 6741507 missense probably benign
R7915:Tox UTSW 4 6822949 missense probably benign
R8223:Tox UTSW 4 6842408 missense probably damaging 1.00
R8766:Tox UTSW 4 6823047 missense probably damaging 0.99
Z1088:Tox UTSW 4 6688450 missense probably damaging 1.00
Z1176:Tox UTSW 4 6990629 start gained probably benign
Predicted Primers PCR Primer
(F):5'- CATCTCATTAACTGGAAACAAGGC -3'
(R):5'- GGAAAGATGTGGCTCACTCAC -3'

Sequencing Primer
(F):5'- TAACTGGAAACAAGGCTTAAATGC -3'
(R):5'- TGTGGCTCACTCACTACAACAGATTC -3'
Posted On2016-09-01