Mutagenetix > Incidental Mutations

Incidental Mutation 'R5421:Kif12'

426553

Institutional Source

Beutler Lab

Gene Symbol

Kif12

Ensembl Gene

ENSMUSG00000028357

Gene Name

kinesin family member 12

Synonyms

N-9 kinesin

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.400) question?

Stock #

R5421 (G1)

Quality Score

210

Status

Not validated

Chromosome

Chromosomal Location

63165630-63172131 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 63171428 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Glycine at position 59 (S59G)

Ref Sequence

ENSEMBL: ENSMUSP00000030042 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000030042] [ENSMUST00000124739] [ENSMUST00000156618]

Predicted Effect

probably benign
Transcript: ENSMUST00000030042
AA Change: S59G

PolyPhen 2 Score 0.402 (Sensitivity: 0.89; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000030042
Gene: ENSMUSG00000028357
AA Change: S59G

Domain	Start	End	E-Value	Type
KISc	23	368	4.46e-108	SMART
coiled coil region	376	464	N/A	INTRINSIC
low complexity region	538	554	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124739
AA Change: S59G

PolyPhen 2 Score 0.397 (Sensitivity: 0.89; Specificity: 0.89)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131760

Predicted Effect

probably benign
Transcript: ENSMUST00000154234

Predicted Effect

probably benign
Transcript: ENSMUST00000156618
AA Change: S59G

PolyPhen 2 Score 0.349 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin superfamily of microtubule-associated molecular motors with functions related to the microtubule cytosekelton. Members of this superfamily play important roles in intracellular transport and cell division. A similar protein in mouse functions in the beta cell antioxidant signaling cascade, acting as a scaffold for the transcription factor specificity protein 1 (Sp1). Mice that lack this gene exhibit beta cell oxidative stress resulting in hypoinsulinemic glucose intolerance. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	A	T	15: 74,550,027	Q882L	probably damaging	Het
Afdn	T	C	17: 13,832,406	V525A	probably benign	Het
AI987944	T	C	7: 41,374,776	T263A	probably benign	Het
Aldh1l2	T	C	10: 83,527,407	S31G	probably damaging	Het
Asxl1	T	C	2: 153,399,584	S685P	probably benign	Het
BC005561	A	T	5: 104,518,395	N261I	probably benign	Het
Blnk	C	A	19: 40,968,523	V47F	probably damaging	Het
Bmp4	T	A	14: 46,385,898	M64L	probably damaging	Het
Bmpr2	T	A	1: 59,870,418	V1017E	possibly damaging	Het
C1ra	C	T	6: 124,522,790	P645L	probably benign	Het
Cadm2	A	T	16: 66,771,627	C248*	probably null	Het
Cd163l1	T	C	7: 140,223,900	L337P	probably damaging	Het
Cdk6	T	C	5: 3,473,120	V180A	probably damaging	Het
Colec12	A	T	18: 9,858,580	R454S	probably damaging	Het
Dennd3	T	C	15: 73,567,115	S1111P	probably benign	Het
Dmxl1	T	C	18: 49,863,119		probably null	Het
Dnah2	G	A	11: 69,435,636	T3613I	probably damaging	Het
Elp6	A	G	9: 110,314,064	Q115R	probably benign	Het
Enpp1	A	G	10: 24,669,757	Y262H	probably damaging	Het
Far2	A	G	6: 148,146,192		probably null	Het
Flnb	C	T	14: 7,926,494	T1846I	probably damaging	Het
Folr2	C	T	7: 101,840,644	R139H	probably benign	Het
Fxn	A	T	19: 24,277,285		probably null	Het
Galnt13	A	C	2: 54,857,896	N263T	probably damaging	Het
Gje1	G	A	10: 14,716,684	S118L	probably damaging	Het
Htr5a	G	T	5: 27,850,987	W325C	possibly damaging	Het
Itga4	T	A	2: 79,316,041	Y772*	probably null	Het
Kifc3	C	T	8: 95,109,845	R96Q	probably damaging	Het
Klrd1	T	C	6: 129,598,443	Y191H	probably damaging	Het
Ndst3	A	T	3: 123,634,359		probably null	Het
Nek1	A	C	8: 61,006,677	R6S	possibly damaging	Het
Olfr142	G	A	2: 90,252,745	T81I	probably benign	Het
Olfr421-ps1	C	T	1: 174,152,295	R260*	probably null	Het
Olfr493	G	C	7: 108,346,975	A2G	probably benign	Het
Palld	C	T	8: 61,516,550	E1005K	probably damaging	Het
Ppp2r1a	T	A	17: 20,956,706	Y169N	probably benign	Het
Rad50	T	C	11: 53,674,946	D960G	probably benign	Het
Rad51ap2	A	T	12: 11,459,367	K915*	probably null	Het
Rasal2	T	C	1: 157,299,141	K109R	probably benign	Het
Rc3h1	G	A	1: 160,951,830		probably null	Het
Rnf6	C	T	5: 146,210,529	V560I	probably benign	Het
Samd8	A	G	14: 21,792,495	D295G	probably damaging	Het
Serpinb2	T	C	1: 107,523,851	Y245H	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc28a3	A	T	13: 58,574,265	F268L	possibly damaging	Het
Slc7a14	T	C	3: 31,224,197	T420A	probably damaging	Het
Speer4f2	A	T	5: 17,374,358	T52S	possibly damaging	Het
Spta1	A	G	1: 174,215,529	N1414D	probably damaging	Het
Sptbn5	A	G	2: 120,080,780		noncoding transcript	Het
Syt9	T	C	7: 107,425,356	V152A	probably benign	Het
Tln1	G	A	4: 43,533,609	A2315V	possibly damaging	Het
Tox	C	A	4: 6,842,409	M40I	possibly damaging	Het
Ucp1	G	A	8: 83,290,691	A37T	probably benign	Het
Vapa	A	G	17: 65,595,036	V33A	possibly damaging	Het
Vmn2r110	A	G	17: 20,583,620	L231S	probably damaging	Het
Vmn2r15	C	T	5: 109,286,535	A768T	probably damaging	Het
Vmn2r86	T	C	10: 130,446,936	T604A	probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wnk1	A	G	6: 119,952,818	V1246A	probably damaging	Het
Wwc1	T	G	11: 35,876,063	D455A	possibly damaging	Het
Wwc1	C	T	11: 35,910,296	E105K	possibly damaging	Het
Zfp426	G	A	9: 20,470,719	A309V	probably damaging	Het
Zfp626	T	A	7: 27,817,910	N105K	probably damaging	Het

Other mutations in Kif12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01306:Kif12	APN	4	63165884	missense	probably damaging	0.99
IGL01377:Kif12	APN	4	63170725	missense	probably damaging	1.00
IGL02232:Kif12	APN	4	63166495	missense	probably benign	0.00
IGL02671:Kif12	APN	4	63170457	missense	probably benign	0.05
IGL02719:Kif12	APN	4	63167796	missense	probably benign
IGL03056:Kif12	APN	4	63166956	missense	probably null	0.00
ANU05:Kif12	UTSW	4	63171423	small insertion	probably benign
ANU23:Kif12	UTSW	4	63165884	missense	probably damaging	0.99
ANU74:Kif12	UTSW	4	63171423	small insertion	probably benign
ANU74:Kif12	UTSW	4	63171426	frame shift	probably null
IGL02984:Kif12	UTSW	4	63171423	small insertion	probably benign
R0401:Kif12	UTSW	4	63169525	splice site	probably benign
R0927:Kif12	UTSW	4	63168773	missense	possibly damaging	0.71
R1589:Kif12	UTSW	4	63166500	missense	probably benign	0.00
R2178:Kif12	UTSW	4	63166959	missense	probably benign	0.00
R2263:Kif12	UTSW	4	63169521	missense	probably benign	0.00
R2372:Kif12	UTSW	4	63168559	missense	possibly damaging	0.64
R2404:Kif12	UTSW	4	63170553	missense	probably damaging	1.00
R3903:Kif12	UTSW	4	63167976	missense	possibly damaging	0.73
R4126:Kif12	UTSW	4	63166437	missense	probably benign	0.00
R4271:Kif12	UTSW	4	63170746	missense	probably benign	0.39
R4386:Kif12	UTSW	4	63171218	missense	probably damaging	1.00
R4750:Kif12	UTSW	4	63167783	missense	probably damaging	0.99
R4945:Kif12	UTSW	4	63168493	critical splice donor site	probably null
R5177:Kif12	UTSW	4	63167904	missense	probably benign	0.13
R5644:Kif12	UTSW	4	63165893	missense	possibly damaging	0.75
R5757:Kif12	UTSW	4	63170518	missense	probably damaging	1.00
R5772:Kif12	UTSW	4	63165941	missense	probably damaging	1.00
R5858:Kif12	UTSW	4	63166410	missense	probably benign	0.04
R5929:Kif12	UTSW	4	63168517	missense	probably damaging	0.96
R6648:Kif12	UTSW	4	63171317	critical splice donor site	probably null
R7007:Kif12	UTSW	4	63166480	missense	probably benign
R7108:Kif12	UTSW	4	63171205	missense	probably benign	0.15
R7171:Kif12	UTSW	4	63168694	missense	probably damaging	1.00
R7852:Kif12	UTSW	4	63167989	missense	probably benign	0.13
RF011:Kif12	UTSW	4	63171427	small insertion	probably benign
RF031:Kif12	UTSW	4	63171425	small insertion	probably benign
RF036:Kif12	UTSW	4	63171427	small insertion	probably benign
RF039:Kif12	UTSW	4	63171425	small insertion	probably benign
RF041:Kif12	UTSW	4	63171425	small insertion	probably benign
T0975:Kif12	UTSW	4	63171423	small insertion	probably benign
Z1088:Kif12	UTSW	4	63171423	small insertion	probably benign
Z1176:Kif12	UTSW	4	63171423	small insertion	probably benign
Z1176:Kif12	UTSW	4	63171997	missense	possibly damaging	0.95
Z1177:Kif12	UTSW	4	63171423	small insertion	probably benign

Predicted Primers

PCR Primer
(F):5'- CAAACGTGAAGACCGTGCAG -3'
(R):5'- ATGCGTCCAACTGGAGCAAC -3'

Sequencing Primer
(F):5'- CAGCAAGGACGTGGCTG -3'
(R):5'- CAACCTTGCTTTAGGACCCC -3'

Posted On

2016-09-01