Incidental Mutation 'R5421:Klrd1'
ID426562
Institutional Source Beutler Lab
Gene Symbol Klrd1
Ensembl Gene ENSMUSG00000030165
Gene Namekiller cell lectin-like receptor, subfamily D, member 1
SynonymsCD94
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location129591782-129598775 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129598443 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 191 (Y191H)
Ref Sequence ENSEMBL: ENSMUSP00000113399 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032268] [ENSMUST00000112063] [ENSMUST00000119520] [ENSMUST00000159804]
Predicted Effect probably damaging
Transcript: ENSMUST00000032268
AA Change: Y148H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032268
Gene: ENSMUSG00000030165
AA Change: Y148H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CLECT 38 151 8.6e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112063
AA Change: Y172H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107694
Gene: ENSMUSG00000030165
AA Change: Y172H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
CLECT 61 175 2.84e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000119520
AA Change: Y191H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113399
Gene: ENSMUSG00000030165
AA Change: Y191H

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
CLECT 61 194 1.41e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159077
Predicted Effect probably benign
Transcript: ENSMUST00000159804
SMART Domains Protein: ENSMUSP00000123703
Gene: ENSMUSG00000030165

DomainStartEndE-ValueType
Blast:CLECT 5 54 5e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000203965
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Natural killer (NK) cells are a distinct lineage of lymphocytes that mediate cytotoxic activity and secrete cytokines upon immune stimulation. Several genes of the C-type lectin superfamily, including members of the NKG2 family, are expressed by NK cells and may be involved in the regulation of NK cell function. KLRD1 (CD94) is an antigen preferentially expressed on NK cells and is classified as a type II membrane protein because it has an external C terminus. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal NK cell function and susceptibillity to infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Klrd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4305001:Klrd1 UTSW 6 129596707 missense unknown
R0056:Klrd1 UTSW 6 129593775 missense probably benign 0.06
R2284:Klrd1 UTSW 6 129598381 missense probably benign 0.09
R2357:Klrd1 UTSW 6 129596909 makesense probably null
R5381:Klrd1 UTSW 6 129595434 missense possibly damaging 0.46
R6090:Klrd1 UTSW 6 129595536 missense probably damaging 1.00
R6897:Klrd1 UTSW 6 129593505 missense possibly damaging 0.94
R7563:Klrd1 UTSW 6 129593738 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- CAAGTGGTTTCCCATATTCTGAG -3'
(R):5'- TCATCTGAACTTTATGCACACGTG -3'

Sequencing Primer
(F):5'- AGTTATCAGGCCAGAGCA -3'
(R):5'- ACACGTGTGAAGAAGCCATC -3'
Posted On2016-09-01