Incidental Mutation 'R5421:Far2'
ID426563
Institutional Source Beutler Lab
Gene Symbol Far2
Ensembl Gene ENSMUSG00000030303
Gene Namefatty acyl CoA reductase 2
SynonymsMlstd1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5421 (G1)
Quality Score179
Status Not validated
Chromosome6
Chromosomal Location148047259-148182758 bp(+) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) A to G at 148146192 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000107234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032443] [ENSMUST00000111607]
Predicted Effect probably null
Transcript: ENSMUST00000032443
SMART Domains Protein: ENSMUSP00000032443
Gene: ENSMUSG00000030303

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 160 5.3e-8 PFAM
Pfam:Epimerase 13 242 7.5e-9 PFAM
Pfam:3Beta_HSD 14 167 3.4e-7 PFAM
Pfam:NAD_binding_4 15 285 3.3e-76 PFAM
Pfam:Sterile 356 448 4.3e-35 PFAM
transmembrane domain 465 484 N/A INTRINSIC
transmembrane domain 491 510 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111607
SMART Domains Protein: ENSMUSP00000107234
Gene: ENSMUSG00000030303

DomainStartEndE-ValueType
Pfam:Polysacc_synt_2 13 159 2.9e-8 PFAM
Pfam:Epimerase 13 241 3.2e-10 PFAM
Pfam:3Beta_HSD 14 167 4.2e-7 PFAM
Pfam:NAD_binding_4 15 285 3.2e-73 PFAM
Pfam:Sterile 355 448 1.2e-29 PFAM
transmembrane domain 466 483 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the short chain dehydrogenase/reductase superfamily. It encodes a reductase enzyme involved in the first step of wax biosynthesis wherein fatty acids are converted to fatty alcohols. The encoded peroxisomal protein utilizes saturated fatty acids of 16 or 18 carbons as preferred substrates. Alternatively spliced transcript variants have been observed for this gene. Related pseudogenes have been identified on chromosomes 2, 14 and 22. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Far2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01131:Far2 APN 6 148150598 missense possibly damaging 0.89
IGL01650:Far2 APN 6 148173487 missense possibly damaging 0.92
IGL01899:Far2 APN 6 148146029 missense probably benign 0.19
IGL02524:Far2 APN 6 148150658 missense probably damaging 1.00
IGL02756:Far2 APN 6 148157391 missense probably damaging 1.00
Galway UTSW 6 148157482 missense probably damaging 0.99
PIT4531001:Far2 UTSW 6 148175131 missense possibly damaging 0.95
R0319:Far2 UTSW 6 148157470 missense probably damaging 0.96
R0654:Far2 UTSW 6 148175141 missense possibly damaging 0.64
R1321:Far2 UTSW 6 148173536 splice site probably benign
R1610:Far2 UTSW 6 148157458 missense possibly damaging 0.71
R2039:Far2 UTSW 6 148165577 missense probably benign
R2471:Far2 UTSW 6 148138694 missense probably damaging 1.00
R3874:Far2 UTSW 6 148150591 missense probably benign 0.00
R3875:Far2 UTSW 6 148150591 missense probably benign 0.00
R3974:Far2 UTSW 6 148150754 missense probably damaging 0.96
R4490:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R4491:Far2 UTSW 6 148173409 missense possibly damaging 0.88
R5034:Far2 UTSW 6 148173441 missense probably benign 0.43
R5673:Far2 UTSW 6 148146104 missense possibly damaging 0.86
R6092:Far2 UTSW 6 148175083 missense probably benign 0.00
R6294:Far2 UTSW 6 148157482 missense probably damaging 0.99
R6325:Far2 UTSW 6 148157497 missense probably benign 0.30
R6783:Far2 UTSW 6 148150775 splice site probably null
R7380:Far2 UTSW 6 148180995 missense unknown
R7403:Far2 UTSW 6 148158977 missense possibly damaging 0.93
R7484:Far2 UTSW 6 148173913 missense probably damaging 1.00
R8276:Far2 UTSW 6 148173901 missense probably benign 0.00
X0053:Far2 UTSW 6 148165640 missense probably benign 0.00
Z1088:Far2 UTSW 6 148138658 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACTTGGCATGTGGATTTC -3'
(R):5'- ACGCTGGGATATGGAGACTTC -3'

Sequencing Primer
(F):5'- CTGTTTCAGCTGTTTGAGAAAGTC -3'
(R):5'- CATTACAGATGGTTGTGAGCCACC -3'
Posted On2016-09-01