Incidental Mutation 'R5421:Folr2'
ID426567
Institutional Source Beutler Lab
Gene Symbol Folr2
Ensembl Gene ENSMUSG00000032725
Gene Namefolate receptor 2 (fetal)
SynonymsFBP2, Folbp-2, FR-P3, Folbp2, Folbp2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location101839988-101857194 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 101840644 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 139 (R139H)
Ref Sequence ENSEMBL: ENSMUSP00000148085 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035836] [ENSMUST00000094141] [ENSMUST00000165052] [ENSMUST00000185929] [ENSMUST00000209329] [ENSMUST00000210598] [ENSMUST00000211566]
Predicted Effect probably benign
Transcript: ENSMUST00000035836
SMART Domains Protein: ENSMUSP00000048057
Gene: ENSMUSG00000032737

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000094141
AA Change: R139H

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091692
Gene: ENSMUSG00000032725
AA Change: R139H

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Folate_rec 29 203 2.5e-64 PFAM
low complexity region 233 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098239
Predicted Effect probably benign
Transcript: ENSMUST00000165052
SMART Domains Protein: ENSMUSP00000132883
Gene: ENSMUSG00000032737

DomainStartEndE-ValueType
SH2 19 108 1.21e-26 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 5e-14 BLAST
IPPc 423 736 3.98e-137 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
SAM 1192 1257 2.47e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185929
SMART Domains Protein: ENSMUSP00000139910
Gene: ENSMUSG00000032737

DomainStartEndE-ValueType
SH2 19 108 7.6e-29 SMART
low complexity region 116 137 N/A INTRINSIC
low complexity region 156 175 N/A INTRINSIC
Blast:IPPc 250 349 4e-14 BLAST
IPPc 423 736 1.9e-139 SMART
low complexity region 934 957 N/A INTRINSIC
low complexity region 997 1013 N/A INTRINSIC
low complexity region 1036 1047 N/A INTRINSIC
low complexity region 1049 1068 N/A INTRINSIC
low complexity region 1089 1102 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209329
AA Change: R139H

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209481
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209861
Predicted Effect probably benign
Transcript: ENSMUST00000210598
AA Change: R139H

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211428
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211514
Predicted Effect probably benign
Transcript: ENSMUST00000211566
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211604
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211793
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a receptor protein located on the plasma membrane that mediates folate uptake by cells. Mice lacking the product of this gene show no defects in embryonic development and grow normally into fertile adults. However, such mice were found to be highly susceptible to the teratogenic effects of arsenic. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and physically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Folr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Folr2 APN 7 101840386 missense probably damaging 0.98
Frontier UTSW 7 101840674 missense probably damaging 0.97
R4214:Folr2 UTSW 7 101843699 missense probably damaging 0.96
R4410:Folr2 UTSW 7 101840674 missense probably damaging 0.97
R4755:Folr2 UTSW 7 101843799 missense possibly damaging 0.86
R4944:Folr2 UTSW 7 101840290 splice site probably null
R7810:Folr2 UTSW 7 101840895 missense possibly damaging 0.89
R8888:Folr2 UTSW 7 101840201 missense unknown
R8895:Folr2 UTSW 7 101840201 missense unknown
Predicted Primers PCR Primer
(F):5'- GTACTCAAACGTGTGACAGGG -3'
(R):5'- CAAGTATGGGTGCTTCCTTCAC -3'

Sequencing Primer
(F):5'- GCACTTGTTAATGCCTGCAG -3'
(R):5'- TCCTTCACATGCTTCAGAAAGG -3'
Posted On2016-09-01