Incidental Mutation 'R5421:Syt9'
ID426569
Institutional Source Beutler Lab
Gene Symbol Syt9
Ensembl Gene ENSMUSG00000062542
Gene Namesynaptotagmin IX
SynonymsSytv
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107370728-107548656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107425356 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 152 (V152A)
Ref Sequence ENSEMBL: ENSMUSP00000122049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073459] [ENSMUST00000130414] [ENSMUST00000137663]
Predicted Effect probably benign
Transcript: ENSMUST00000073459
AA Change: V152A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073164
Gene: ENSMUSG00000062542
AA Change: V152A

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 7e-54 BLAST
C2 236 339 1.8e-26 SMART
C2 368 482 1.6e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130414
AA Change: V152A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000122049
Gene: ENSMUSG00000062542
AA Change: V152A

DomainStartEndE-ValueType
low complexity region 37 49 N/A INTRINSIC
Blast:C2 53 166 3e-57 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000137663
SMART Domains Protein: ENSMUSP00000117969
Gene: ENSMUSG00000062542

DomainStartEndE-ValueType
low complexity region 37 48 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit 50% embryonic lethality while cre-mediated removal of a conditional allele impairs inhibitions of postsynaptic currents. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Syt9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Syt9 APN 7 107425367 nonsense probably null
IGL00541:Syt9 APN 7 107502180 missense probably null 1.00
IGL01161:Syt9 APN 7 107425149 missense probably damaging 0.97
IGL01705:Syt9 APN 7 107436352 missense probably damaging 0.96
IGL02567:Syt9 APN 7 107436661 missense probably damaging 1.00
IGL03268:Syt9 APN 7 107436405 missense probably benign 0.01
R0684:Syt9 UTSW 7 107425136 missense probably damaging 1.00
R0743:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R0835:Syt9 UTSW 7 107506530 missense probably benign 0.30
R0884:Syt9 UTSW 7 107436561 missense probably damaging 0.97
R1114:Syt9 UTSW 7 107425355 missense possibly damaging 0.93
R1502:Syt9 UTSW 7 107436487 missense probably damaging 1.00
R1885:Syt9 UTSW 7 107436529 missense probably damaging 1.00
R1962:Syt9 UTSW 7 107425107 missense probably damaging 1.00
R2368:Syt9 UTSW 7 107436699 missense probably damaging 1.00
R2421:Syt9 UTSW 7 107436781 missense probably benign 0.39
R4134:Syt9 UTSW 7 107436423 missense probably benign 0.22
R4477:Syt9 UTSW 7 107425221 missense probably damaging 1.00
R4602:Syt9 UTSW 7 107436387 nonsense probably null
R4685:Syt9 UTSW 7 107436471 missense possibly damaging 0.89
R4977:Syt9 UTSW 7 107504272 missense probably damaging 1.00
R5141:Syt9 UTSW 7 107504219 missense probably damaging 1.00
R5440:Syt9 UTSW 7 107502123 missense possibly damaging 0.46
R5633:Syt9 UTSW 7 107425296 missense probably damaging 1.00
R5978:Syt9 UTSW 7 107436413 missense probably benign 0.02
R6260:Syt9 UTSW 7 107436510 missense possibly damaging 0.93
R6733:Syt9 UTSW 7 107425296 missense probably damaging 1.00
R6889:Syt9 UTSW 7 107425286 missense probably damaging 0.99
R7572:Syt9 UTSW 7 107436577 missense probably damaging 1.00
R8080:Syt9 UTSW 7 107436790 missense probably benign
X0018:Syt9 UTSW 7 107506574 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- TGTTCTCTGGTAGCAAAGACAAC -3'
(R):5'- AAACTAAGCTGAGCTCTGGC -3'

Sequencing Primer
(F):5'- TCTGGTAGCAAAGACAACAACCAAG -3'
(R):5'- ACTAAGCTGAGCTCTGGCACTAG -3'
Posted On2016-09-01