Incidental Mutation 'R5421:Or5p68'
ID 426570
Institutional Source Beutler Lab
Gene Symbol Or5p68
Ensembl Gene ENSMUSG00000093980
Gene Name olfactory receptor family 5 subfamily P member 68
Synonyms MOR204-35, GA_x6K02T2PBJ9-10676998-10676054, Olfr493
Accession Numbers
Essential gene? Probably non essential (E-score: 0.082) question?
Stock # R5421 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 107945242-107946186 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to C at 107946182 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 2 (A2G)
Ref Sequence ENSEMBL: ENSMUSP00000079005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080106]
AlphaFold Q8VEW5
Predicted Effect probably benign
Transcript: ENSMUST00000080106
AA Change: A2G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079005
Gene: ENSMUSG00000093980
AA Change: A2G

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 7.1e-55 PFAM
Pfam:7tm_1 44 293 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,421,876 (GRCm39) Q882L probably damaging Het
Afdn T C 17: 14,052,668 (GRCm39) V525A probably benign Het
AI987944 T C 7: 41,024,200 (GRCm39) T263A probably benign Het
Aldh1l2 T C 10: 83,363,271 (GRCm39) S31G probably damaging Het
Asxl1 T C 2: 153,241,504 (GRCm39) S685P probably benign Het
Blnk C A 19: 40,956,967 (GRCm39) V47F probably damaging Het
Bmp4 T A 14: 46,623,355 (GRCm39) M64L probably damaging Het
Bmpr2 T A 1: 59,909,577 (GRCm39) V1017E possibly damaging Het
C1ra C T 6: 124,499,749 (GRCm39) P645L probably benign Het
Cadm2 A T 16: 66,568,513 (GRCm39) C248* probably null Het
Cdk6 T C 5: 3,523,120 (GRCm39) V180A probably damaging Het
Colec12 A T 18: 9,858,580 (GRCm39) R454S probably damaging Het
Dennd3 T C 15: 73,438,964 (GRCm39) S1111P probably benign Het
Dmxl1 T C 18: 49,996,186 (GRCm39) probably null Het
Dnah2 G A 11: 69,326,462 (GRCm39) T3613I probably damaging Het
Elp6 A G 9: 110,143,132 (GRCm39) Q115R probably benign Het
Enpp1 A G 10: 24,545,655 (GRCm39) Y262H probably damaging Het
Far2 A G 6: 148,047,690 (GRCm39) probably null Het
Flnb C T 14: 7,926,494 (GRCm38) T1846I probably damaging Het
Folr2 C T 7: 101,489,851 (GRCm39) R139H probably benign Het
Fxn A T 19: 24,254,649 (GRCm39) probably null Het
Galnt13 A C 2: 54,747,908 (GRCm39) N263T probably damaging Het
Gje1 G A 10: 14,592,428 (GRCm39) S118L probably damaging Het
Htr5a G T 5: 28,055,985 (GRCm39) W325C possibly damaging Het
Itga4 T A 2: 79,146,385 (GRCm39) Y772* probably null Het
Kif12 T C 4: 63,089,665 (GRCm39) S59G probably benign Het
Kifc3 C T 8: 95,836,473 (GRCm39) R96Q probably damaging Het
Klrd1 T C 6: 129,575,406 (GRCm39) Y191H probably damaging Het
Ndst3 A T 3: 123,428,008 (GRCm39) probably null Het
Nek1 A C 8: 61,459,711 (GRCm39) R6S possibly damaging Het
Or4b13 G A 2: 90,083,089 (GRCm39) T81I probably benign Het
Or6k8-ps1 C T 1: 173,979,861 (GRCm39) R260* probably null Het
Palld C T 8: 61,969,584 (GRCm39) E1005K probably damaging Het
Ppp2r1a T A 17: 21,176,968 (GRCm39) Y169N probably benign Het
Rad50 T C 11: 53,565,773 (GRCm39) D960G probably benign Het
Rad51ap2 A T 12: 11,509,368 (GRCm39) K915* probably null Het
Rasal2 T C 1: 157,126,711 (GRCm39) K109R probably benign Het
Rc3h1 G A 1: 160,779,400 (GRCm39) probably null Het
Rnf6 C T 5: 146,147,339 (GRCm39) V560I probably benign Het
Samd8 A G 14: 21,842,563 (GRCm39) D295G probably damaging Het
Scart1 T C 7: 139,803,813 (GRCm39) L337P probably damaging Het
Serpinb2 T C 1: 107,451,581 (GRCm39) Y245H probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc28a3 A T 13: 58,722,079 (GRCm39) F268L possibly damaging Het
Slc7a14 T C 3: 31,278,346 (GRCm39) T420A probably damaging Het
Speer4f2 A T 5: 17,579,356 (GRCm39) T52S possibly damaging Het
Spta1 A G 1: 174,043,095 (GRCm39) N1414D probably damaging Het
Sptbn5 A G 2: 119,911,261 (GRCm39) noncoding transcript Het
Syt9 T C 7: 107,024,563 (GRCm39) V152A probably benign Het
Thoc2l A T 5: 104,666,261 (GRCm39) N261I probably benign Het
Tln1 G A 4: 43,533,609 (GRCm39) A2315V possibly damaging Het
Tox C A 4: 6,842,409 (GRCm39) M40I possibly damaging Het
Ucp1 G A 8: 84,017,320 (GRCm39) A37T probably benign Het
Vapa A G 17: 65,902,031 (GRCm39) V33A possibly damaging Het
Vmn2r110 A G 17: 20,803,882 (GRCm39) L231S probably damaging Het
Vmn2r15 C T 5: 109,434,401 (GRCm39) A768T probably damaging Het
Vmn2r86 T C 10: 130,282,805 (GRCm39) T604A probably benign Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnk1 A G 6: 119,929,779 (GRCm39) V1246A probably damaging Het
Wwc1 C T 11: 35,801,123 (GRCm39) E105K possibly damaging Het
Wwc1 T G 11: 35,766,890 (GRCm39) D455A possibly damaging Het
Zfp426 G A 9: 20,382,015 (GRCm39) A309V probably damaging Het
Zfp626 T A 7: 27,517,335 (GRCm39) N105K probably damaging Het
Other mutations in Or5p68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Or5p68 APN 7 107,946,156 (GRCm39) missense probably benign 0.00
IGL02087:Or5p68 APN 7 107,946,173 (GRCm39) missense probably benign
IGL02484:Or5p68 APN 7 107,945,813 (GRCm39) missense probably damaging 1.00
IGL02961:Or5p68 APN 7 107,945,334 (GRCm39) missense probably benign 0.08
IGL03379:Or5p68 APN 7 107,946,196 (GRCm39) unclassified probably benign
PIT4486001:Or5p68 UTSW 7 107,945,529 (GRCm39) missense possibly damaging 0.95
R0281:Or5p68 UTSW 7 107,946,121 (GRCm39) missense probably benign 0.00
R0285:Or5p68 UTSW 7 107,945,706 (GRCm39) missense probably benign 0.02
R1222:Or5p68 UTSW 7 107,945,313 (GRCm39) missense probably damaging 1.00
R1912:Or5p68 UTSW 7 107,946,014 (GRCm39) missense probably damaging 0.98
R4178:Or5p68 UTSW 7 107,945,765 (GRCm39) missense probably benign 0.00
R5239:Or5p68 UTSW 7 107,945,853 (GRCm39) missense probably benign 0.03
R5452:Or5p68 UTSW 7 107,945,312 (GRCm39) missense probably damaging 1.00
R6991:Or5p68 UTSW 7 107,945,295 (GRCm39) missense possibly damaging 0.92
R7372:Or5p68 UTSW 7 107,945,703 (GRCm39) missense probably benign 0.00
R7374:Or5p68 UTSW 7 107,946,095 (GRCm39) missense probably damaging 1.00
R7571:Or5p68 UTSW 7 107,945,689 (GRCm39) missense probably benign 0.00
R8232:Or5p68 UTSW 7 107,945,495 (GRCm39) missense probably damaging 0.97
R8354:Or5p68 UTSW 7 107,945,889 (GRCm39) missense probably damaging 1.00
R8454:Or5p68 UTSW 7 107,945,889 (GRCm39) missense probably damaging 1.00
R8914:Or5p68 UTSW 7 107,945,759 (GRCm39) missense probably benign 0.01
R9087:Or5p68 UTSW 7 107,945,958 (GRCm39) missense probably damaging 1.00
R9258:Or5p68 UTSW 7 107,945,886 (GRCm39) missense probably benign 0.21
R9608:Or5p68 UTSW 7 107,945,513 (GRCm39) missense probably damaging 1.00
R9751:Or5p68 UTSW 7 107,945,645 (GRCm39) missense probably benign 0.02
X0025:Or5p68 UTSW 7 107,945,808 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGATGAGTAGCCTATGTCAACAG -3'
(R):5'- GCAAACACTGAGAGTCCAATG -3'

Sequencing Primer
(F):5'- TGAGTAGCCTATGTCAACAGAAGCC -3'
(R):5'- ACACTGAGAGTCCAATGTAACTC -3'
Posted On 2016-09-01