Incidental Mutation 'R5421:Olfr493'
ID 426570
Institutional Source Beutler Lab
Gene Symbol Olfr493
Ensembl Gene ENSMUSG00000093980
Gene Name olfactory receptor 493
Synonyms MOR204-35, GA_x6K02T2PBJ9-10676998-10676054
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock # R5421 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 108346035-108346979 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to C at 108346975 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Glycine at position 2 (A2G)
Ref Sequence ENSEMBL: ENSMUSP00000079005 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080106]
AlphaFold Q8VEW5
Predicted Effect probably benign
Transcript: ENSMUST00000080106
AA Change: A2G

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000079005
Gene: ENSMUSG00000093980
AA Change: A2G

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 7.1e-55 PFAM
Pfam:7tm_1 44 293 1.1e-22 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Olfr493
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01152:Olfr493 APN 7 108346949 missense probably benign 0.00
IGL02087:Olfr493 APN 7 108346966 missense probably benign
IGL02484:Olfr493 APN 7 108346606 missense probably damaging 1.00
IGL02961:Olfr493 APN 7 108346127 missense probably benign 0.08
IGL03379:Olfr493 APN 7 108346989 unclassified probably benign
PIT4486001:Olfr493 UTSW 7 108346322 missense possibly damaging 0.95
R0281:Olfr493 UTSW 7 108346914 missense probably benign 0.00
R0285:Olfr493 UTSW 7 108346499 missense probably benign 0.02
R1222:Olfr493 UTSW 7 108346106 missense probably damaging 1.00
R1912:Olfr493 UTSW 7 108346807 missense probably damaging 0.98
R4178:Olfr493 UTSW 7 108346558 missense probably benign 0.00
R5239:Olfr493 UTSW 7 108346646 missense probably benign 0.03
R5452:Olfr493 UTSW 7 108346105 missense probably damaging 1.00
R6991:Olfr493 UTSW 7 108346088 missense possibly damaging 0.92
R7372:Olfr493 UTSW 7 108346496 missense probably benign 0.00
R7374:Olfr493 UTSW 7 108346888 missense probably damaging 1.00
R7571:Olfr493 UTSW 7 108346482 missense probably benign 0.00
R8232:Olfr493 UTSW 7 108346288 missense probably damaging 0.97
R8354:Olfr493 UTSW 7 108346682 missense probably damaging 1.00
R8454:Olfr493 UTSW 7 108346682 missense probably damaging 1.00
R8914:Olfr493 UTSW 7 108346552 missense probably benign 0.01
R9087:Olfr493 UTSW 7 108346751 missense probably damaging 1.00
R9258:Olfr493 UTSW 7 108346679 missense probably benign 0.21
R9608:Olfr493 UTSW 7 108346306 missense probably damaging 1.00
R9751:Olfr493 UTSW 7 108346438 missense probably benign 0.02
X0025:Olfr493 UTSW 7 108346601 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAGATGAGTAGCCTATGTCAACAG -3'
(R):5'- GCAAACACTGAGAGTCCAATG -3'

Sequencing Primer
(F):5'- TGAGTAGCCTATGTCAACAGAAGCC -3'
(R):5'- ACACTGAGAGTCCAATGTAACTC -3'
Posted On 2016-09-01