Mutagenetix > Incidental Mutation

Incidental Mutation 'R5421:Nek1'

426572

Institutional Source

Beutler Lab

Gene Symbol

Nek1

Ensembl Gene

ENSMUSG00000031644

Gene Name

NIMA (never in mitosis gene a)-related expressed kinase 1

Synonyms

kidney, anemia and testis, kat, D8Ertd790e

Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5421 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

60993195-61131346 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 61006677 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 6 (R6S)

Ref Sequence

ENSEMBL: ENSMUSP00000147258 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]

AlphaFold

P51954

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034065
AA Change: R6S

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: R6S

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	556	592	N/A	INTRINSIC
coiled coil region	647	685	N/A	INTRINSIC
low complexity region	767	780	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000120689
AA Change: R6S

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: R6S

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	487	510	N/A	INTRINSIC
low complexity region	521	533	N/A	INTRINSIC
coiled coil region	584	620	N/A	INTRINSIC
coiled coil region	675	713	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC
low complexity region	1158	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125717

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140444

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000154313

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155664

Predicted Effect

possibly damaging
Transcript: ENSMUST00000211256
AA Change: R6S

PolyPhen 2 Score 0.813 (Sensitivity: 0.84; Specificity: 0.93)

Predicted Effect

probably benign
Transcript: ENSMUST00000211672
AA Change: R6S

PolyPhen 2 Score 0.182 (Sensitivity: 0.92; Specificity: 0.87)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	A	T	15: 74,550,027	Q882L	probably damaging	Het
Afdn	T	C	17: 13,832,406	V525A	probably benign	Het
AI987944	T	C	7: 41,374,776	T263A	probably benign	Het
Aldh1l2	T	C	10: 83,527,407	S31G	probably damaging	Het
Asxl1	T	C	2: 153,399,584	S685P	probably benign	Het
BC005561	A	T	5: 104,518,395	N261I	probably benign	Het
Blnk	C	A	19: 40,968,523	V47F	probably damaging	Het
Bmp4	T	A	14: 46,385,898	M64L	probably damaging	Het
Bmpr2	T	A	1: 59,870,418	V1017E	possibly damaging	Het
C1ra	C	T	6: 124,522,790	P645L	probably benign	Het
Cadm2	A	T	16: 66,771,627	C248*	probably null	Het
Cd163l1	T	C	7: 140,223,900	L337P	probably damaging	Het
Cdk6	T	C	5: 3,473,120	V180A	probably damaging	Het
Colec12	A	T	18: 9,858,580	R454S	probably damaging	Het
Dennd3	T	C	15: 73,567,115	S1111P	probably benign	Het
Dmxl1	T	C	18: 49,863,119		probably null	Het
Dnah2	G	A	11: 69,435,636	T3613I	probably damaging	Het
Elp6	A	G	9: 110,314,064	Q115R	probably benign	Het
Enpp1	A	G	10: 24,669,757	Y262H	probably damaging	Het
Far2	A	G	6: 148,146,192		probably null	Het
Flnb	C	T	14: 7,926,494	T1846I	probably damaging	Het
Folr2	C	T	7: 101,840,644	R139H	probably benign	Het
Fxn	A	T	19: 24,277,285		probably null	Het
Galnt13	A	C	2: 54,857,896	N263T	probably damaging	Het
Gje1	G	A	10: 14,716,684	S118L	probably damaging	Het
Htr5a	G	T	5: 27,850,987	W325C	possibly damaging	Het
Itga4	T	A	2: 79,316,041	Y772*	probably null	Het
Kif12	T	C	4: 63,171,428	S59G	probably benign	Het
Kifc3	C	T	8: 95,109,845	R96Q	probably damaging	Het
Klrd1	T	C	6: 129,598,443	Y191H	probably damaging	Het
Ndst3	A	T	3: 123,634,359		probably null	Het
Olfr142	G	A	2: 90,252,745	T81I	probably benign	Het
Olfr421-ps1	C	T	1: 174,152,295	R260*	probably null	Het
Olfr493	G	C	7: 108,346,975	A2G	probably benign	Het
Palld	C	T	8: 61,516,550	E1005K	probably damaging	Het
Ppp2r1a	T	A	17: 20,956,706	Y169N	probably benign	Het
Rad50	T	C	11: 53,674,946	D960G	probably benign	Het
Rad51ap2	A	T	12: 11,459,367	K915*	probably null	Het
Rasal2	T	C	1: 157,299,141	K109R	probably benign	Het
Rc3h1	G	A	1: 160,951,830		probably null	Het
Rnf6	C	T	5: 146,210,529	V560I	probably benign	Het
Samd8	A	G	14: 21,792,495	D295G	probably damaging	Het
Serpinb2	T	C	1: 107,523,851	Y245H	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc28a3	A	T	13: 58,574,265	F268L	possibly damaging	Het
Slc7a14	T	C	3: 31,224,197	T420A	probably damaging	Het
Speer4f2	A	T	5: 17,374,358	T52S	possibly damaging	Het
Spta1	A	G	1: 174,215,529	N1414D	probably damaging	Het
Sptbn5	A	G	2: 120,080,780		noncoding transcript	Het
Syt9	T	C	7: 107,425,356	V152A	probably benign	Het
Tln1	G	A	4: 43,533,609	A2315V	possibly damaging	Het
Tox	C	A	4: 6,842,409	M40I	possibly damaging	Het
Ucp1	G	A	8: 83,290,691	A37T	probably benign	Het
Vapa	A	G	17: 65,595,036	V33A	possibly damaging	Het
Vmn2r110	A	G	17: 20,583,620	L231S	probably damaging	Het
Vmn2r15	C	T	5: 109,286,535	A768T	probably damaging	Het
Vmn2r86	T	C	10: 130,446,936	T604A	probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wnk1	A	G	6: 119,952,818	V1246A	probably damaging	Het
Wwc1	T	G	11: 35,876,063	D455A	possibly damaging	Het
Wwc1	C	T	11: 35,910,296	E105K	possibly damaging	Het
Zfp426	G	A	9: 20,470,719	A309V	probably damaging	Het
Zfp626	T	A	7: 27,817,910	N105K	probably damaging	Het

Other mutations in Nek1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Nek1	APN	8	61043284	missense	probably benign	0.00
IGL01075:Nek1	APN	8	61124132	missense	possibly damaging	0.64
IGL01122:Nek1	APN	8	61120966	missense	possibly damaging	0.80
IGL01151:Nek1	APN	8	61020077	missense	probably damaging	1.00
IGL01286:Nek1	APN	8	61124216	missense	possibly damaging	0.64
IGL01377:Nek1	APN	8	61089456	missense	probably benign
IGL01485:Nek1	APN	8	61049826	missense	probably benign	0.02
IGL01688:Nek1	APN	8	61105597	nonsense	probably null
IGL01806:Nek1	APN	8	61124212	missense	possibly damaging	0.82
IGL02006:Nek1	APN	8	61104192	missense	probably benign	0.20
IGL02304:Nek1	APN	8	61012167	missense	probably damaging	1.00
IGL02659:Nek1	APN	8	61089480	missense	probably benign	0.16
IGL02662:Nek1	APN	8	61104184	missense	probably benign	0.00
IGL02801:Nek1	APN	8	61121061	critical splice donor site	probably null
IGL02806:Nek1	APN	8	61044086	missense	probably benign	0.15
IGL03037:Nek1	APN	8	61034052	missense	probably benign	0.16
IGL03252:Nek1	APN	8	61072330	nonsense	probably null
P0014:Nek1	UTSW	8	61071747	splice site	probably benign
R0019:Nek1	UTSW	8	61089734	missense	probably benign	0.01
R0403:Nek1	UTSW	8	61106855	missense	probably damaging	0.99
R0464:Nek1	UTSW	8	61072273	splice site	probably benign
R0726:Nek1	UTSW	8	61089592	missense	probably damaging	1.00
R0761:Nek1	UTSW	8	61089455	missense	probably benign
R0827:Nek1	UTSW	8	61105648	splice site	probably benign
R0972:Nek1	UTSW	8	61089431	splice site	probably null
R1268:Nek1	UTSW	8	61022264	missense	probably damaging	1.00
R1343:Nek1	UTSW	8	61028675	missense	probably damaging	1.00
R1415:Nek1	UTSW	8	61089686	missense	probably benign	0.00
R1466:Nek1	UTSW	8	61125136	splice site	probably benign
R1480:Nek1	UTSW	8	61124326	splice site	probably null
R1526:Nek1	UTSW	8	61049941	missense	probably benign	0.26
R1552:Nek1	UTSW	8	61006737	missense	probably damaging	0.99
R1606:Nek1	UTSW	8	61124276	missense	possibly damaging	0.82
R1650:Nek1	UTSW	8	61036076	missense	probably benign	0.00
R1757:Nek1	UTSW	8	61089813	splice site	probably null
R1808:Nek1	UTSW	8	61016230	missense	probably damaging	1.00
R1966:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R2067:Nek1	UTSW	8	61007162	missense	probably damaging	1.00
R2111:Nek1	UTSW	8	61124326	splice site	probably null
R2113:Nek1	UTSW	8	61016293	missense	probably damaging	1.00
R2143:Nek1	UTSW	8	61028696	missense	probably damaging	1.00
R2255:Nek1	UTSW	8	61089773	missense	probably damaging	1.00
R2422:Nek1	UTSW	8	61019901	missense	probably damaging	1.00
R3848:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3849:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3850:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R4418:Nek1	UTSW	8	61106864	missense	probably damaging	1.00
R4526:Nek1	UTSW	8	61106944	missense	probably damaging	0.99
R4533:Nek1	UTSW	8	61007213	missense	possibly damaging	0.95
R4544:Nek1	UTSW	8	61016304	nonsense	probably null
R4677:Nek1	UTSW	8	61028806	missense	probably damaging	0.99
R4739:Nek1	UTSW	8	61098511	missense	probably benign	0.32
R5068:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R5516:Nek1	UTSW	8	61089489	missense	probably benign	0.03
R5855:Nek1	UTSW	8	61016272	missense	probably damaging	1.00
R6125:Nek1	UTSW	8	61028701	missense	probably damaging	1.00
R6267:Nek1	UTSW	8	61072309	nonsense	probably null
R6292:Nek1	UTSW	8	61054736	splice site	probably null
R6296:Nek1	UTSW	8	61072309	nonsense	probably null
R6458:Nek1	UTSW	8	61100012	missense	probably benign	0.00
R6568:Nek1	UTSW	8	61106821	missense	probably benign	0.00
R6629:Nek1	UTSW	8	61054333	splice site	probably null
R6867:Nek1	UTSW	8	61072330	missense	possibly damaging	0.81
R7122:Nek1	UTSW	8	61106795	missense	probably benign	0.00
R7193:Nek1	UTSW	8	61073578	missense	probably damaging	0.99
R7272:Nek1	UTSW	8	61125086	missense	probably benign	0.34
R7356:Nek1	UTSW	8	61120960	missense	probably benign	0.02
R7368:Nek1	UTSW	8	61089707	missense	probably benign	0.24
R7478:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7479:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7512:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7715:Nek1	UTSW	8	61006760	missense	probably damaging	0.98
R7984:Nek1	UTSW	8	61121053	nonsense	probably null
R8271:Nek1	UTSW	8	61105612	missense	probably benign	0.04
R8431:Nek1	UTSW	8	61034032	missense	possibly damaging	0.95
R9076:Nek1	UTSW	8	61028734	missense	probably damaging	0.96
R9149:Nek1	UTSW	8	61121021	missense	probably damaging	1.00
R9250:Nek1	UTSW	8	61012117	missense	probably damaging	0.99
R9429:Nek1	UTSW	8	61106858	missense	probably benign
R9563:Nek1	UTSW	8	61124123	missense	probably benign	0.36
R9616:Nek1	UTSW	8	61020073	missense	probably damaging	0.99
RF023:Nek1	UTSW	8	61072745	splice site	probably null
X0028:Nek1	UTSW	8	61043258	missense	probably benign	0.19
X0066:Nek1	UTSW	8	61125128	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- ATAAAGCTGAAACCGCTCTTTC -3'
(R):5'- ACAGATCCCTCAGAAACTAGTGTTCC -3'

Sequencing Primer
(F):5'- AAAGCTGAAACCGCTCTTTCTTTTTG -3'
(R):5'- CTCAGAAACTAGTGTTCCTCAGTGG -3'

Posted On

2016-09-01