Mutagenetix > Incidental Mutations

Incidental Mutation 'R5421:Palld'

426573

Institutional Source

Beutler Lab

Gene Symbol

Palld

Ensembl Gene

ENSMUSG00000058056

Gene Name

palladin, cytoskeletal associated protein

Synonyms

2410003B16Rik

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5421 (G1)

Quality Score

215

Status

Not validated

Chromosome

Chromosomal Location

61511433-61902690 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 61516550 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 1005 (E1005K)

Ref Sequence

ENSEMBL: ENSMUSP00000034057 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034057] [ENSMUST00000121200] [ENSMUST00000121493] [ENSMUST00000121785] [ENSMUST00000135439]

PDB Structure

NMR structure of Ig3 domain of palladin [SOLUTION NMR]

Predicted Effect

probably damaging
Transcript: ENSMUST00000034057
AA Change: E1005K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000034057
Gene: ENSMUSG00000058056
AA Change: E1005K

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	667	N/A	INTRINSIC
IGc2	796	865	3.1e-9	SMART
low complexity region	881	906	N/A	INTRINSIC
IGc2	930	998	4.92e-12	SMART
IGc2	1029	1098	1.61e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121200
AA Change: E502K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112374
Gene: ENSMUSG00000058056
AA Change: E502K

Domain	Start	End	E-Value	Type
low complexity region	37	68	N/A	INTRINSIC
low complexity region	77	112	N/A	INTRINSIC
IGc2	293	362	3.1e-9	SMART
low complexity region	378	403	N/A	INTRINSIC
IGc2	427	495	4.92e-12	SMART
IGc2	526	595	1.61e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000121493
AA Change: E841K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000113874
Gene: ENSMUSG00000058056
AA Change: E841K

Domain	Start	End	E-Value	Type
IGc2	71	146	1.6e-11	SMART
low complexity region	250	284	N/A	INTRINSIC
low complexity region	298	326	N/A	INTRINSIC
low complexity region	376	407	N/A	INTRINSIC
low complexity region	416	451	N/A	INTRINSIC
IGc2	632	701	3.1e-9	SMART
low complexity region	717	742	N/A	INTRINSIC
IGc2	766	834	4.92e-12	SMART
IGc2	865	934	1.61e-7	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000121785
AA Change: E1247K

SMART Domains

Protein: ENSMUSP00000112442
Gene: ENSMUSG00000058056
AA Change: E1247K

Domain	Start	End	E-Value	Type
IGc2	290	358	1.45e-9	SMART
low complexity region	372	385	N/A	INTRINSIC
IGc2	460	535	1.6e-11	SMART
low complexity region	639	673	N/A	INTRINSIC
low complexity region	687	715	N/A	INTRINSIC
low complexity region	765	796	N/A	INTRINSIC
low complexity region	805	840	N/A	INTRINSIC
IGc2	1038	1107	3.1e-9	SMART
low complexity region	1123	1148	N/A	INTRINSIC
IGc2	1172	1240	4.92e-12	SMART
IGc2	1271	1340	1.61e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000135439
AA Change: E291K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000119792
Gene: ENSMUSG00000058056
AA Change: E291K

Domain	Start	End	E-Value	Type
IGc2	82	151	3.1e-9	SMART
low complexity region	167	192	N/A	INTRINSIC
IGc2	216	284	4.92e-12	SMART
internal_repeat_1	302	336	1.47e-9	PROSPERO

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153495

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoskeletal protein that is required for organizing the actin cytoskeleton. The protein is a component of actin-containing microfilaments, and it is involved in the control of cell shape, adhesion, and contraction. Polymorphisms in this gene are associated with a susceptibility to pancreatic cancer type 1, and also with a risk for myocardial infarction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: All homozygous null embryos die around E15.5 displaying exencephaly derived from neural tube closure defects, and herniation of the intestine and liver due to ventral closure defects. Mutant MEFs show impaired formation of actin stress fibers, reduced migration and decreased adhesion to fibronectin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	A	T	15: 74,550,027	Q882L	probably damaging	Het
Afdn	T	C	17: 13,832,406	V525A	probably benign	Het
AI987944	T	C	7: 41,374,776	T263A	probably benign	Het
Aldh1l2	T	C	10: 83,527,407	S31G	probably damaging	Het
Asxl1	T	C	2: 153,399,584	S685P	probably benign	Het
BC005561	A	T	5: 104,518,395	N261I	probably benign	Het
Blnk	C	A	19: 40,968,523	V47F	probably damaging	Het
Bmp4	T	A	14: 46,385,898	M64L	probably damaging	Het
Bmpr2	T	A	1: 59,870,418	V1017E	possibly damaging	Het
C1ra	C	T	6: 124,522,790	P645L	probably benign	Het
Cadm2	A	T	16: 66,771,627	C248*	probably null	Het
Cd163l1	T	C	7: 140,223,900	L337P	probably damaging	Het
Cdk6	T	C	5: 3,473,120	V180A	probably damaging	Het
Colec12	A	T	18: 9,858,580	R454S	probably damaging	Het
Dennd3	T	C	15: 73,567,115	S1111P	probably benign	Het
Dmxl1	T	C	18: 49,863,119		probably null	Het
Dnah2	G	A	11: 69,435,636	T3613I	probably damaging	Het
Elp6	A	G	9: 110,314,064	Q115R	probably benign	Het
Enpp1	A	G	10: 24,669,757	Y262H	probably damaging	Het
Far2	A	G	6: 148,146,192		probably null	Het
Flnb	C	T	14: 7,926,494	T1846I	probably damaging	Het
Folr2	C	T	7: 101,840,644	R139H	probably benign	Het
Fxn	A	T	19: 24,277,285		probably null	Het
Galnt13	A	C	2: 54,857,896	N263T	probably damaging	Het
Gje1	G	A	10: 14,716,684	S118L	probably damaging	Het
Htr5a	G	T	5: 27,850,987	W325C	possibly damaging	Het
Itga4	T	A	2: 79,316,041	Y772*	probably null	Het
Kif12	T	C	4: 63,171,428	S59G	probably benign	Het
Kifc3	C	T	8: 95,109,845	R96Q	probably damaging	Het
Klrd1	T	C	6: 129,598,443	Y191H	probably damaging	Het
Ndst3	A	T	3: 123,634,359		probably null	Het
Nek1	A	C	8: 61,006,677	R6S	possibly damaging	Het
Olfr142	G	A	2: 90,252,745	T81I	probably benign	Het
Olfr421-ps1	C	T	1: 174,152,295	R260*	probably null	Het
Olfr493	G	C	7: 108,346,975	A2G	probably benign	Het
Ppp2r1a	T	A	17: 20,956,706	Y169N	probably benign	Het
Rad50	T	C	11: 53,674,946	D960G	probably benign	Het
Rad51ap2	A	T	12: 11,459,367	K915*	probably null	Het
Rasal2	T	C	1: 157,299,141	K109R	probably benign	Het
Rc3h1	G	A	1: 160,951,830		probably null	Het
Rnf6	C	T	5: 146,210,529	V560I	probably benign	Het
Samd8	A	G	14: 21,792,495	D295G	probably damaging	Het
Serpinb2	T	C	1: 107,523,851	Y245H	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc28a3	A	T	13: 58,574,265	F268L	possibly damaging	Het
Slc7a14	T	C	3: 31,224,197	T420A	probably damaging	Het
Speer4f2	A	T	5: 17,374,358	T52S	possibly damaging	Het
Spta1	A	G	1: 174,215,529	N1414D	probably damaging	Het
Sptbn5	A	G	2: 120,080,780		noncoding transcript	Het
Syt9	T	C	7: 107,425,356	V152A	probably benign	Het
Tln1	G	A	4: 43,533,609	A2315V	possibly damaging	Het
Tox	C	A	4: 6,842,409	M40I	possibly damaging	Het
Ucp1	G	A	8: 83,290,691	A37T	probably benign	Het
Vapa	A	G	17: 65,595,036	V33A	possibly damaging	Het
Vmn2r110	A	G	17: 20,583,620	L231S	probably damaging	Het
Vmn2r15	C	T	5: 109,286,535	A768T	probably damaging	Het
Vmn2r86	T	C	10: 130,446,936	T604A	probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wnk1	A	G	6: 119,952,818	V1246A	probably damaging	Het
Wwc1	T	G	11: 35,876,063	D455A	possibly damaging	Het
Wwc1	C	T	11: 35,910,296	E105K	possibly damaging	Het
Zfp426	G	A	9: 20,470,719	A309V	probably damaging	Het
Zfp626	T	A	7: 27,817,910	N105K	probably damaging	Het

Other mutations in Palld

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00917:Palld	APN	8	61515935	missense	possibly damaging	0.77
IGL01083:Palld	APN	8	61538807	missense	probably benign	0.44
IGL01644:Palld	APN	8	61877478	missense	probably benign	0.28
IGL01672:Palld	APN	8	61877502	missense	probably benign	0.22
IGL01941:Palld	APN	8	61535700	missense	probably benign	0.44
IGL02037:Palld	APN	8	61525114	missense	probably damaging	1.00
IGL02126:Palld	APN	8	61877442	missense	possibly damaging	0.82
IGL02537:Palld	APN	8	61684934	missense	probably benign	0.05
IGL02632:Palld	APN	8	61515245	missense	probably damaging	1.00
IGL02809:Palld	APN	8	61515247	missense	probably damaging	1.00
IGL02901:Palld	APN	8	61876995	nonsense	probably null
IGL03400:Palld	APN	8	61513455	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0098:Palld	UTSW	8	61525086	missense	probably damaging	1.00
R0745:Palld	UTSW	8	61877703	missense	probably damaging	1.00
R1263:Palld	UTSW	8	61513457	frame shift	probably null
R1342:Palld	UTSW	8	61522882	critical splice donor site	probably null
R1893:Palld	UTSW	8	61516621	missense	probably damaging	1.00
R2017:Palld	UTSW	8	61684765	missense	probably damaging	0.99
R2102:Palld	UTSW	8	61533433	missense	possibly damaging	0.82
R2129:Palld	UTSW	8	61877361	missense	probably benign	0.00
R2246:Palld	UTSW	8	61877135	missense	probably benign	0.01
R3545:Palld	UTSW	8	61550078	missense	possibly damaging	0.95
R3815:Palld	UTSW	8	61549837	intron	probably benign
R3824:Palld	UTSW	8	61709033	missense	probably damaging	1.00
R4412:Palld	UTSW	8	61687372	missense	probably damaging	0.98
R4781:Palld	UTSW	8	61877028	missense	probably benign	0.01
R4836:Palld	UTSW	8	61687381	missense	probably benign	0.11
R4871:Palld	UTSW	8	61549781	intron	probably benign
R4963:Palld	UTSW	8	61703210	missense	probably damaging	1.00
R5036:Palld	UTSW	8	61550162	missense	probably damaging	1.00
R5128:Palld	UTSW	8	61720588	missense	probably damaging	1.00
R5343:Palld	UTSW	8	61549815	intron	probably benign
R5427:Palld	UTSW	8	61550072	missense	probably benign	0.01
R5561:Palld	UTSW	8	61516585	missense	probably damaging	1.00
R5651:Palld	UTSW	8	61538788	missense	probably damaging	1.00
R5679:Palld	UTSW	8	61684945	missense	possibly damaging	0.95
R5915:Palld	UTSW	8	61533352	critical splice donor site	probably null
R6153:Palld	UTSW	8	61550152	missense	probably damaging	1.00
R6276:Palld	UTSW	8	61513423	missense	probably damaging	1.00
R6323:Palld	UTSW	8	61720693	missense	probably damaging	1.00
R6659:Palld	UTSW	8	61533443	missense	probably benign	0.28
R7016:Palld	UTSW	8	61515998	missense	probably damaging	1.00
R7124:Palld	UTSW	8	61516645	missense	unknown
R7145:Palld	UTSW	8	61532017	missense	unknown
R7386:Palld	UTSW	8	61532052	missense	unknown
R7407:Palld	UTSW	8	61515941	nonsense	probably null
R7723:Palld	UTSW	8	61711458	missense	probably damaging	1.00
R7962:Palld	UTSW	8	61516530	splice site	probably null
R8029:Palld	UTSW	8	61877312	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGTCAACAGGCTCGCACAG -3'
(R):5'- AGATCTCAGCTGGCAACTAGATG -3'

Sequencing Primer
(F):5'- GTGCCGAGTATTTCAGCACCAG -3'
(R):5'- CTGGCAACTAGATGGAAAGCCC -3'

Posted On

2016-09-01