Incidental Mutation 'R5421:Enpp1'
ID 426579
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms PC-1, E-NPP1, Npps, Pca, Pdnp1, CD203c, twy, NPP1, 4833416E15Rik, Pca-1, Ly-41
Accession Numbers
Essential gene? Probably non essential (E-score: 0.195) question?
Stock # R5421 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 24513812-24588057 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24545655 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Histidine at position 262 (Y262H)
Ref Sequence ENSEMBL: ENSMUSP00000101159 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039882
AA Change: Y262H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370
AA Change: Y262H

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105520
AA Change: Y262H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: Y262H

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000135846
AA Change: Y262H

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: Y262H

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142974
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150570
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,421,876 (GRCm39) Q882L probably damaging Het
Afdn T C 17: 14,052,668 (GRCm39) V525A probably benign Het
AI987944 T C 7: 41,024,200 (GRCm39) T263A probably benign Het
Aldh1l2 T C 10: 83,363,271 (GRCm39) S31G probably damaging Het
Asxl1 T C 2: 153,241,504 (GRCm39) S685P probably benign Het
Blnk C A 19: 40,956,967 (GRCm39) V47F probably damaging Het
Bmp4 T A 14: 46,623,355 (GRCm39) M64L probably damaging Het
Bmpr2 T A 1: 59,909,577 (GRCm39) V1017E possibly damaging Het
C1ra C T 6: 124,499,749 (GRCm39) P645L probably benign Het
Cadm2 A T 16: 66,568,513 (GRCm39) C248* probably null Het
Cdk6 T C 5: 3,523,120 (GRCm39) V180A probably damaging Het
Colec12 A T 18: 9,858,580 (GRCm39) R454S probably damaging Het
Dennd3 T C 15: 73,438,964 (GRCm39) S1111P probably benign Het
Dmxl1 T C 18: 49,996,186 (GRCm39) probably null Het
Dnah2 G A 11: 69,326,462 (GRCm39) T3613I probably damaging Het
Elp6 A G 9: 110,143,132 (GRCm39) Q115R probably benign Het
Far2 A G 6: 148,047,690 (GRCm39) probably null Het
Flnb C T 14: 7,926,494 (GRCm38) T1846I probably damaging Het
Folr2 C T 7: 101,489,851 (GRCm39) R139H probably benign Het
Fxn A T 19: 24,254,649 (GRCm39) probably null Het
Galnt13 A C 2: 54,747,908 (GRCm39) N263T probably damaging Het
Gje1 G A 10: 14,592,428 (GRCm39) S118L probably damaging Het
Htr5a G T 5: 28,055,985 (GRCm39) W325C possibly damaging Het
Itga4 T A 2: 79,146,385 (GRCm39) Y772* probably null Het
Kif12 T C 4: 63,089,665 (GRCm39) S59G probably benign Het
Kifc3 C T 8: 95,836,473 (GRCm39) R96Q probably damaging Het
Klrd1 T C 6: 129,575,406 (GRCm39) Y191H probably damaging Het
Ndst3 A T 3: 123,428,008 (GRCm39) probably null Het
Nek1 A C 8: 61,459,711 (GRCm39) R6S possibly damaging Het
Or4b13 G A 2: 90,083,089 (GRCm39) T81I probably benign Het
Or5p68 G C 7: 107,946,182 (GRCm39) A2G probably benign Het
Or6k8-ps1 C T 1: 173,979,861 (GRCm39) R260* probably null Het
Palld C T 8: 61,969,584 (GRCm39) E1005K probably damaging Het
Ppp2r1a T A 17: 21,176,968 (GRCm39) Y169N probably benign Het
Rad50 T C 11: 53,565,773 (GRCm39) D960G probably benign Het
Rad51ap2 A T 12: 11,509,368 (GRCm39) K915* probably null Het
Rasal2 T C 1: 157,126,711 (GRCm39) K109R probably benign Het
Rc3h1 G A 1: 160,779,400 (GRCm39) probably null Het
Rnf6 C T 5: 146,147,339 (GRCm39) V560I probably benign Het
Samd8 A G 14: 21,842,563 (GRCm39) D295G probably damaging Het
Scart1 T C 7: 139,803,813 (GRCm39) L337P probably damaging Het
Serpinb2 T C 1: 107,451,581 (GRCm39) Y245H probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc28a3 A T 13: 58,722,079 (GRCm39) F268L possibly damaging Het
Slc7a14 T C 3: 31,278,346 (GRCm39) T420A probably damaging Het
Speer4f2 A T 5: 17,579,356 (GRCm39) T52S possibly damaging Het
Spta1 A G 1: 174,043,095 (GRCm39) N1414D probably damaging Het
Sptbn5 A G 2: 119,911,261 (GRCm39) noncoding transcript Het
Syt9 T C 7: 107,024,563 (GRCm39) V152A probably benign Het
Thoc2l A T 5: 104,666,261 (GRCm39) N261I probably benign Het
Tln1 G A 4: 43,533,609 (GRCm39) A2315V possibly damaging Het
Tox C A 4: 6,842,409 (GRCm39) M40I possibly damaging Het
Ucp1 G A 8: 84,017,320 (GRCm39) A37T probably benign Het
Vapa A G 17: 65,902,031 (GRCm39) V33A possibly damaging Het
Vmn2r110 A G 17: 20,803,882 (GRCm39) L231S probably damaging Het
Vmn2r15 C T 5: 109,434,401 (GRCm39) A768T probably damaging Het
Vmn2r86 T C 10: 130,282,805 (GRCm39) T604A probably benign Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnk1 A G 6: 119,929,779 (GRCm39) V1246A probably damaging Het
Wwc1 C T 11: 35,801,123 (GRCm39) E105K possibly damaging Het
Wwc1 T G 11: 35,766,890 (GRCm39) D455A possibly damaging Het
Zfp426 G A 9: 20,382,015 (GRCm39) A309V probably damaging Het
Zfp626 T A 7: 27,517,335 (GRCm39) N105K probably damaging Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24,521,325 (GRCm39) missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24,529,929 (GRCm39) missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24,540,512 (GRCm39) missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24,531,754 (GRCm39) missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24,517,859 (GRCm39) missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24,555,083 (GRCm39) splice site probably benign
IGL02691:Enpp1 APN 10 24,587,790 (GRCm39) missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24,536,172 (GRCm39) missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24,531,779 (GRCm39) splice site probably benign
IGL03330:Enpp1 APN 10 24,540,804 (GRCm39) splice site probably benign
IGL03365:Enpp1 APN 10 24,544,923 (GRCm39) missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24,536,181 (GRCm39) critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24,529,848 (GRCm39) missense probably benign 0.16
R0011:Enpp1 UTSW 10 24,545,900 (GRCm39) nonsense probably null
R0201:Enpp1 UTSW 10 24,529,815 (GRCm39) missense probably benign 0.00
R0496:Enpp1 UTSW 10 24,547,950 (GRCm39) missense probably benign 0.18
R1228:Enpp1 UTSW 10 24,521,310 (GRCm39) missense probably benign 0.30
R1536:Enpp1 UTSW 10 24,517,732 (GRCm39) missense probably benign 0.27
R1927:Enpp1 UTSW 10 24,530,786 (GRCm39) missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24,587,702 (GRCm39) critical splice donor site probably null
R2057:Enpp1 UTSW 10 24,536,090 (GRCm39) missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24,527,239 (GRCm39) missense probably benign 0.24
R4077:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4079:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4739:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4740:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4761:Enpp1 UTSW 10 24,517,849 (GRCm39) missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24,537,833 (GRCm39) missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24,523,983 (GRCm39) missense probably benign 0.01
R5140:Enpp1 UTSW 10 24,528,750 (GRCm39) missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24,527,288 (GRCm39) missense probably benign
R5695:Enpp1 UTSW 10 24,530,806 (GRCm39) missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24,530,817 (GRCm39) missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24,523,137 (GRCm39) missense probably benign
R5942:Enpp1 UTSW 10 24,551,966 (GRCm39) nonsense probably null
R6048:Enpp1 UTSW 10 24,536,152 (GRCm39) missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24,533,024 (GRCm39) missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24,517,780 (GRCm39) missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24,523,929 (GRCm39) missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24,545,653 (GRCm39) nonsense probably null
R6793:Enpp1 UTSW 10 24,531,723 (GRCm39) missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24,527,237 (GRCm39) missense probably benign 0.30
R7255:Enpp1 UTSW 10 24,521,213 (GRCm39) missense possibly damaging 0.95
R7285:Enpp1 UTSW 10 24,536,059 (GRCm39) missense probably benign 0.01
R7401:Enpp1 UTSW 10 24,521,180 (GRCm39) missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7430:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7526:Enpp1 UTSW 10 24,550,308 (GRCm39) splice site probably null
R7532:Enpp1 UTSW 10 24,551,885 (GRCm39) missense probably benign 0.29
R7789:Enpp1 UTSW 10 24,529,981 (GRCm39) splice site probably null
R8073:Enpp1 UTSW 10 24,555,142 (GRCm39) missense possibly damaging 0.50
R8283:Enpp1 UTSW 10 24,550,554 (GRCm39) missense probably benign 0.25
R8955:Enpp1 UTSW 10 24,544,926 (GRCm39) missense probably benign 0.01
R9494:Enpp1 UTSW 10 24,527,234 (GRCm39) missense probably benign
Z1177:Enpp1 UTSW 10 24,537,840 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CATATGAGACAGTCAACAGTCGC -3'
(R):5'- AGCATCGTCACAGTAAGTAGGC -3'

Sequencing Primer
(F):5'- ACAGTCGCCTGCAACAGTTTG -3'
(R):5'- TAAGTAGGCACTAGGCACACTCTG -3'
Posted On 2016-09-01