Incidental Mutation 'R5421:Wwc1'
ID426583
Institutional Source Beutler Lab
Gene Symbol Wwc1
Ensembl Gene ENSMUSG00000018849
Gene NameWW, C2 and coiled-coil domain containing 1
SynonymsKibra
Accession Numbers

NCBI RefSeq: NM_170779.1; MGI: 2388637

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location35838400-35980527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 35910296 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 105 (E105K)
Ref Sequence ENSEMBL: ENSMUSP00000018993 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018993]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018993
AA Change: E105K

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000018993
Gene: ENSMUSG00000018849
AA Change: E105K

DomainStartEndE-ValueType
WW 7 39 7.96e-12 SMART
WW 54 86 5.22e-7 SMART
coiled coil region 107 133 N/A INTRINSIC
low complexity region 139 153 N/A INTRINSIC
coiled coil region 158 193 N/A INTRINSIC
low complexity region 255 270 N/A INTRINSIC
coiled coil region 294 330 N/A INTRINSIC
low complexity region 341 353 N/A INTRINSIC
coiled coil region 360 431 N/A INTRINSIC
low complexity region 527 549 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
Pfam:C2 674 784 8.3e-7 PFAM
low complexity region 842 860 N/A INTRINSIC
coiled coil region 994 1024 N/A INTRINSIC
low complexity region 1026 1040 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 5301655
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic phosphoprotein that interacts with PRKC-zeta and dynein light chain-1. Alleles of this gene have been found that enhance memory in some individuals. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired adult synaptic plasticity and fear-based conditioning. [provided by MGI curators]
Allele List at MGI

All alleles(11) : Targeted(1) Gene trapped(10

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Wwc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Wwc1 APN 11 35844202 missense possibly damaging 0.82
IGL01161:Wwc1 APN 11 35867276 missense probably damaging 1.00
IGL01401:Wwc1 APN 11 35898618 critical splice donor site probably null
IGL01771:Wwc1 APN 11 35853358 critical splice donor site probably null
IGL01804:Wwc1 APN 11 35841924 missense probably damaging 1.00
IGL02079:Wwc1 APN 11 35876058 missense probably damaging 1.00
IGL02201:Wwc1 APN 11 35844151 splice site probably benign
IGL03376:Wwc1 APN 11 35852294 missense possibly damaging 0.80
IGL03403:Wwc1 APN 11 35915284 missense possibly damaging 0.94
BB002:Wwc1 UTSW 11 35844163 missense probably benign 0.00
BB012:Wwc1 UTSW 11 35844163 missense probably benign 0.00
P0008:Wwc1 UTSW 11 35853351 splice site probably benign
R0277:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0321:Wwc1 UTSW 11 35841810 nonsense probably null
R0323:Wwc1 UTSW 11 35852348 missense probably damaging 0.99
R0629:Wwc1 UTSW 11 35853472 missense probably benign 0.18
R1302:Wwc1 UTSW 11 35844157 missense probably damaging 1.00
R1769:Wwc1 UTSW 11 35861844 missense probably benign
R1870:Wwc1 UTSW 11 35861945 missense probably damaging 1.00
R2000:Wwc1 UTSW 11 35876547 missense probably damaging 1.00
R2074:Wwc1 UTSW 11 35889353 missense possibly damaging 0.62
R2138:Wwc1 UTSW 11 35841887 missense possibly damaging 0.47
R2140:Wwc1 UTSW 11 35870528 missense probably benign 0.01
R2680:Wwc1 UTSW 11 35875929 missense probably benign 0.23
R3864:Wwc1 UTSW 11 35910316 missense probably damaging 1.00
R4773:Wwc1 UTSW 11 35867296 missense probably benign
R4926:Wwc1 UTSW 11 35889400 missense probably benign 0.17
R4980:Wwc1 UTSW 11 35888103 missense possibly damaging 0.93
R4990:Wwc1 UTSW 11 35876566 missense probably benign 0.00
R5044:Wwc1 UTSW 11 35883345 missense probably benign 0.45
R5238:Wwc1 UTSW 11 35875896 missense probably benign 0.02
R5421:Wwc1 UTSW 11 35876063 missense possibly damaging 0.81
R5461:Wwc1 UTSW 11 35867372 missense probably damaging 1.00
R5705:Wwc1 UTSW 11 35876596 missense probably damaging 0.99
R5847:Wwc1 UTSW 11 35867326 missense probably damaging 1.00
R5993:Wwc1 UTSW 11 35852336 missense probably benign 0.17
R6006:Wwc1 UTSW 11 35870982 missense probably null 1.00
R6006:Wwc1 UTSW 11 35889273 missense probably damaging 0.98
R6516:Wwc1 UTSW 11 35867302 missense probably benign 0.05
R6519:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6520:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6525:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6526:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6527:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R6528:Wwc1 UTSW 11 35853437 missense probably benign 0.04
R7060:Wwc1 UTSW 11 35915176 missense possibly damaging 0.74
R7156:Wwc1 UTSW 11 35897374 critical splice donor site probably null
R7448:Wwc1 UTSW 11 35875706 missense probably benign
R7586:Wwc1 UTSW 11 35844195 missense possibly damaging 0.69
R7793:Wwc1 UTSW 11 35869109 missense probably benign 0.21
R7925:Wwc1 UTSW 11 35844163 missense probably benign 0.00
R8296:Wwc1 UTSW 11 35870557 splice site probably benign
R8369:Wwc1 UTSW 11 35867371 missense probably damaging 1.00
R8735:Wwc1 UTSW 11 35883407 missense probably damaging 1.00
R8804:Wwc1 UTSW 11 35883317 missense probably benign 0.30
X0025:Wwc1 UTSW 11 35876040 missense possibly damaging 0.95
Z1088:Wwc1 UTSW 11 35883482 missense possibly damaging 0.62
Predicted Primers PCR Primer
(F):5'- TAGTCCCTGCTGTGCTAGTCAG -3'
(R):5'- TGCCATGTAGTGAGTTTAACCC -3'

Sequencing Primer
(F):5'- CTAGTCAGGGATGCTGGCAATG -3'
(R):5'- TGACGAGTCTCTGTACATCATG -3'
Posted On2016-09-01