Incidental Mutation 'R5421:Rad51ap2'
ID426586
Institutional Source Beutler Lab
Gene Symbol Rad51ap2
Ensembl Gene ENSMUSG00000086022
Gene NameRAD51 associated protein 2
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location11456079-11462928 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 11459367 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 915 (K915*)
Ref Sequence ENSEMBL: ENSMUSP00000128854 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000124065]
Predicted Effect probably null
Transcript: ENSMUST00000124065
AA Change: K915*
SMART Domains Protein: ENSMUSP00000128854
Gene: ENSMUSG00000086022
AA Change: K915*

DomainStartEndE-ValueType
low complexity region 17 32 N/A INTRINSIC
low complexity region 428 438 N/A INTRINSIC
low complexity region 702 713 N/A INTRINSIC
Pfam:RAD51_interact 937 975 1.3e-20 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Rad51ap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01879:Rad51ap2 APN 12 11458138 missense probably benign 0.10
IGL01908:Rad51ap2 APN 12 11458591 missense probably damaging 1.00
IGL02415:Rad51ap2 APN 12 11456929 missense possibly damaging 0.91
IGL02731:Rad51ap2 APN 12 11456896 missense probably damaging 0.99
IGL03407:Rad51ap2 APN 12 11457197 missense possibly damaging 0.96
R0190:Rad51ap2 UTSW 12 11458539 missense probably benign 0.01
R0281:Rad51ap2 UTSW 12 11457042 missense possibly damaging 0.93
R0564:Rad51ap2 UTSW 12 11457896 missense probably benign 0.20
R0674:Rad51ap2 UTSW 12 11458817 critical splice donor site probably null
R0699:Rad51ap2 UTSW 12 11457600 missense probably benign 0.03
R1033:Rad51ap2 UTSW 12 11456251 missense probably damaging 0.98
R1255:Rad51ap2 UTSW 12 11458094 missense possibly damaging 0.54
R1572:Rad51ap2 UTSW 12 11457112 missense probably damaging 0.99
R1746:Rad51ap2 UTSW 12 11457775 missense probably benign
R1882:Rad51ap2 UTSW 12 11456250 missense possibly damaging 0.85
R2038:Rad51ap2 UTSW 12 11457024 missense possibly damaging 0.73
R2151:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2152:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2154:Rad51ap2 UTSW 12 11457985 missense probably benign 0.02
R2159:Rad51ap2 UTSW 12 11457751 missense possibly damaging 0.87
R2321:Rad51ap2 UTSW 12 11457057 missense probably damaging 1.00
R2355:Rad51ap2 UTSW 12 11457108 missense probably benign
R2393:Rad51ap2 UTSW 12 11457797 missense probably damaging 0.98
R2407:Rad51ap2 UTSW 12 11458501 missense probably damaging 0.99
R2518:Rad51ap2 UTSW 12 11457067 missense probably damaging 0.99
R2929:Rad51ap2 UTSW 12 11457184 missense probably benign 0.07
R3085:Rad51ap2 UTSW 12 11456757 missense possibly damaging 0.53
R4009:Rad51ap2 UTSW 12 11457051 missense probably benign 0.33
R4108:Rad51ap2 UTSW 12 11458395 missense probably damaging 1.00
R4282:Rad51ap2 UTSW 12 11456464 missense probably benign 0.01
R4536:Rad51ap2 UTSW 12 11457849 missense possibly damaging 0.90
R4594:Rad51ap2 UTSW 12 11457880 missense probably benign 0.01
R4678:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4679:Rad51ap2 UTSW 12 11456551 missense probably damaging 0.96
R4810:Rad51ap2 UTSW 12 11457405 missense probably damaging 1.00
R5151:Rad51ap2 UTSW 12 11457515 missense probably benign 0.09
R5517:Rad51ap2 UTSW 12 11458312 missense probably benign 0.19
R5786:Rad51ap2 UTSW 12 11456920 missense probably damaging 1.00
R5884:Rad51ap2 UTSW 12 11457533 small deletion probably benign
R5932:Rad51ap2 UTSW 12 11458386 missense probably damaging 1.00
R6022:Rad51ap2 UTSW 12 11458522 missense probably damaging 1.00
R6064:Rad51ap2 UTSW 12 11457417 missense possibly damaging 0.80
R6112:Rad51ap2 UTSW 12 11457289 missense probably benign 0.01
R6235:Rad51ap2 UTSW 12 11457516 missense possibly damaging 0.70
R6282:Rad51ap2 UTSW 12 11457559 missense probably benign 0.12
R6488:Rad51ap2 UTSW 12 11458160 missense possibly damaging 0.56
R6668:Rad51ap2 UTSW 12 11457646 missense probably benign 0.17
R6759:Rad51ap2 UTSW 12 11457144 missense possibly damaging 0.91
R7030:Rad51ap2 UTSW 12 11457431 missense possibly damaging 0.93
R7080:Rad51ap2 UTSW 12 11456365 missense probably benign
R7105:Rad51ap2 UTSW 12 11458277 missense possibly damaging 0.84
R7269:Rad51ap2 UTSW 12 11456806 missense possibly damaging 0.67
R7286:Rad51ap2 UTSW 12 11457691 missense probably benign 0.19
R7305:Rad51ap2 UTSW 12 11457343 missense possibly damaging 0.68
R7451:Rad51ap2 UTSW 12 11457981 missense probably benign 0.05
R7632:Rad51ap2 UTSW 12 11457115 missense possibly damaging 0.85
R7833:Rad51ap2 UTSW 12 11456655 missense probably benign
R7839:Rad51ap2 UTSW 12 11457237 missense possibly damaging 0.83
R7953:Rad51ap2 UTSW 12 11462592 nonsense probably null
R8040:Rad51ap2 UTSW 12 11458791 missense probably benign 0.03
RF023:Rad51ap2 UTSW 12 11458075 missense possibly damaging 0.94
X0026:Rad51ap2 UTSW 12 11458096 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- GAGAAAGCTCAGGAGTCTTATTTAAG -3'
(R):5'- CTGTTCAGAGGACACCTTCC -3'

Sequencing Primer
(F):5'- AGCTCAGGAGTCTTATTTAAGTTTTC -3'
(R):5'- CAAGGTAGTTTCACCATGC -3'
Posted On2016-09-01