Incidental Mutation 'R5421:Samd8'
ID426589
Institutional Source Beutler Lab
Gene Symbol Samd8
Ensembl Gene ENSMUSG00000021770
Gene Namesterile alpha motif domain containing 8
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.452) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location21750531-21798726 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21792495 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 295 (D295G)
Ref Sequence ENSEMBL: ENSMUSP00000112803 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022292] [ENSMUST00000119430] [ENSMUST00000144061]
Predicted Effect probably damaging
Transcript: ENSMUST00000022292
AA Change: D358G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022292
Gene: ENSMUSG00000021770
AA Change: D358G

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
SAM 72 141 1.86e-3 SMART
transmembrane domain 215 237 N/A INTRINSIC
transmembrane domain 262 284 N/A INTRINSIC
transmembrane domain 297 319 N/A INTRINSIC
Pfam:PAP2_C 355 428 3e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000119430
AA Change: D295G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112803
Gene: ENSMUSG00000021770
AA Change: D295G

DomainStartEndE-ValueType
SAM 9 78 1.86e-3 SMART
transmembrane domain 152 174 N/A INTRINSIC
transmembrane domain 199 221 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Pfam:PAP2_C 292 365 6.1e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142023
Predicted Effect probably benign
Transcript: ENSMUST00000144061
SMART Domains Protein: ENSMUSP00000117603
Gene: ENSMUSG00000021770

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased ceramide phosphoethanolamine synthase activity but normal liver, kidney and spleen histology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Samd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01762:Samd8 APN 14 21780100 missense probably damaging 1.00
IGL01837:Samd8 APN 14 21774959 splice site probably benign
IGL02188:Samd8 APN 14 21783798 critical splice donor site probably null
IGL02338:Samd8 APN 14 21775476 missense possibly damaging 0.95
IGL02437:Samd8 APN 14 21775423 missense probably benign 0.11
IGL02643:Samd8 APN 14 21793144 missense probably damaging 1.00
skellington UTSW 14 21783798 critical splice donor site probably null
Stern UTSW 14 21775153 missense possibly damaging 0.79
wellington UTSW 14 21775137 missense probably damaging 1.00
R0993:Samd8 UTSW 14 21775495 missense probably damaging 1.00
R1529:Samd8 UTSW 14 21775159 missense possibly damaging 0.53
R2200:Samd8 UTSW 14 21775320 missense probably benign 0.00
R3801:Samd8 UTSW 14 21775065 missense probably damaging 0.99
R3803:Samd8 UTSW 14 21775065 missense probably damaging 0.99
R3981:Samd8 UTSW 14 21780180 missense probably null 1.00
R4094:Samd8 UTSW 14 21793045 missense probably damaging 1.00
R4232:Samd8 UTSW 14 21780145 missense probably benign
R4847:Samd8 UTSW 14 21792435 missense possibly damaging 0.65
R5402:Samd8 UTSW 14 21775168 missense probably damaging 1.00
R5955:Samd8 UTSW 14 21793084 missense probably damaging 1.00
R6180:Samd8 UTSW 14 21775025 missense probably benign 0.04
R6447:Samd8 UTSW 14 21792556 critical splice donor site probably null
R6451:Samd8 UTSW 14 21783798 critical splice donor site probably null
R6844:Samd8 UTSW 14 21775137 missense probably damaging 1.00
R6914:Samd8 UTSW 14 21775153 missense possibly damaging 0.79
R6942:Samd8 UTSW 14 21775153 missense possibly damaging 0.79
R7101:Samd8 UTSW 14 21775374 missense probably benign 0.00
R7485:Samd8 UTSW 14 21792423 missense probably benign 0.00
R8256:Samd8 UTSW 14 21783677 critical splice acceptor site probably null
R8280:Samd8 UTSW 14 21780151 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AATTGCCTGAAATGGATTTGGG -3'
(R):5'- CAGGGTAGGCTCTAAGCTTCTG -3'

Sequencing Primer
(F):5'- CCTGAAATGGATTTGGGCAAGCTC -3'
(R):5'- TGAACTAGGATCTACAGGCATCTGC -3'
Posted On2016-09-01