Incidental Mutation 'R5421:Sh3bp5'
ID 426590
Institutional Source Beutler Lab
Gene Symbol Sh3bp5
Ensembl Gene ENSMUSG00000021892
Gene Name SH3-domain binding protein 5 (BTK-associated)
Synonyms Sab
Accession Numbers
Essential gene? Probably non essential (E-score: 0.228) question?
Stock # R5421 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 31094571-31158056 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 31099452 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 265 (R265L)
Ref Sequence ENSEMBL: ENSMUSP00000117152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091903] [ENSMUST00000100730] [ENSMUST00000140002]
AlphaFold Q9Z131
Predicted Effect probably benign
Transcript: ENSMUST00000091903
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000089517
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.2e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100730
AA Change: R263L

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000098296
Gene: ENSMUSG00000021892
AA Change: R263L

DomainStartEndE-ValueType
Pfam:SH3BP5 60 274 5.5e-95 PFAM
low complexity region 321 333 N/A INTRINSIC
low complexity region 405 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140002
AA Change: R265L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000117152
Gene: ENSMUSG00000021892
AA Change: R265L

DomainStartEndE-ValueType
Pfam:SH3BP5 42 272 2.3e-99 PFAM
low complexity region 323 335 N/A INTRINSIC
low complexity region 407 428 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147586
Meta Mutation Damage Score 0.2831 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,421,876 (GRCm39) Q882L probably damaging Het
Afdn T C 17: 14,052,668 (GRCm39) V525A probably benign Het
AI987944 T C 7: 41,024,200 (GRCm39) T263A probably benign Het
Aldh1l2 T C 10: 83,363,271 (GRCm39) S31G probably damaging Het
Asxl1 T C 2: 153,241,504 (GRCm39) S685P probably benign Het
Blnk C A 19: 40,956,967 (GRCm39) V47F probably damaging Het
Bmp4 T A 14: 46,623,355 (GRCm39) M64L probably damaging Het
Bmpr2 T A 1: 59,909,577 (GRCm39) V1017E possibly damaging Het
C1ra C T 6: 124,499,749 (GRCm39) P645L probably benign Het
Cadm2 A T 16: 66,568,513 (GRCm39) C248* probably null Het
Cdk6 T C 5: 3,523,120 (GRCm39) V180A probably damaging Het
Colec12 A T 18: 9,858,580 (GRCm39) R454S probably damaging Het
Dennd3 T C 15: 73,438,964 (GRCm39) S1111P probably benign Het
Dmxl1 T C 18: 49,996,186 (GRCm39) probably null Het
Dnah2 G A 11: 69,326,462 (GRCm39) T3613I probably damaging Het
Elp6 A G 9: 110,143,132 (GRCm39) Q115R probably benign Het
Enpp1 A G 10: 24,545,655 (GRCm39) Y262H probably damaging Het
Far2 A G 6: 148,047,690 (GRCm39) probably null Het
Flnb C T 14: 7,926,494 (GRCm38) T1846I probably damaging Het
Folr2 C T 7: 101,489,851 (GRCm39) R139H probably benign Het
Fxn A T 19: 24,254,649 (GRCm39) probably null Het
Galnt13 A C 2: 54,747,908 (GRCm39) N263T probably damaging Het
Gje1 G A 10: 14,592,428 (GRCm39) S118L probably damaging Het
Htr5a G T 5: 28,055,985 (GRCm39) W325C possibly damaging Het
Itga4 T A 2: 79,146,385 (GRCm39) Y772* probably null Het
Kif12 T C 4: 63,089,665 (GRCm39) S59G probably benign Het
Kifc3 C T 8: 95,836,473 (GRCm39) R96Q probably damaging Het
Klrd1 T C 6: 129,575,406 (GRCm39) Y191H probably damaging Het
Ndst3 A T 3: 123,428,008 (GRCm39) probably null Het
Nek1 A C 8: 61,459,711 (GRCm39) R6S possibly damaging Het
Or4b13 G A 2: 90,083,089 (GRCm39) T81I probably benign Het
Or5p68 G C 7: 107,946,182 (GRCm39) A2G probably benign Het
Or6k8-ps1 C T 1: 173,979,861 (GRCm39) R260* probably null Het
Palld C T 8: 61,969,584 (GRCm39) E1005K probably damaging Het
Ppp2r1a T A 17: 21,176,968 (GRCm39) Y169N probably benign Het
Rad50 T C 11: 53,565,773 (GRCm39) D960G probably benign Het
Rad51ap2 A T 12: 11,509,368 (GRCm39) K915* probably null Het
Rasal2 T C 1: 157,126,711 (GRCm39) K109R probably benign Het
Rc3h1 G A 1: 160,779,400 (GRCm39) probably null Het
Rnf6 C T 5: 146,147,339 (GRCm39) V560I probably benign Het
Samd8 A G 14: 21,842,563 (GRCm39) D295G probably damaging Het
Scart1 T C 7: 139,803,813 (GRCm39) L337P probably damaging Het
Serpinb2 T C 1: 107,451,581 (GRCm39) Y245H probably damaging Het
Slc28a3 A T 13: 58,722,079 (GRCm39) F268L possibly damaging Het
Slc7a14 T C 3: 31,278,346 (GRCm39) T420A probably damaging Het
Speer4f2 A T 5: 17,579,356 (GRCm39) T52S possibly damaging Het
Spta1 A G 1: 174,043,095 (GRCm39) N1414D probably damaging Het
Sptbn5 A G 2: 119,911,261 (GRCm39) noncoding transcript Het
Syt9 T C 7: 107,024,563 (GRCm39) V152A probably benign Het
Thoc2l A T 5: 104,666,261 (GRCm39) N261I probably benign Het
Tln1 G A 4: 43,533,609 (GRCm39) A2315V possibly damaging Het
Tox C A 4: 6,842,409 (GRCm39) M40I possibly damaging Het
Ucp1 G A 8: 84,017,320 (GRCm39) A37T probably benign Het
Vapa A G 17: 65,902,031 (GRCm39) V33A possibly damaging Het
Vmn2r110 A G 17: 20,803,882 (GRCm39) L231S probably damaging Het
Vmn2r15 C T 5: 109,434,401 (GRCm39) A768T probably damaging Het
Vmn2r86 T C 10: 130,282,805 (GRCm39) T604A probably benign Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Wnk1 A G 6: 119,929,779 (GRCm39) V1246A probably damaging Het
Wwc1 C T 11: 35,801,123 (GRCm39) E105K possibly damaging Het
Wwc1 T G 11: 35,766,890 (GRCm39) D455A possibly damaging Het
Zfp426 G A 9: 20,382,015 (GRCm39) A309V probably damaging Het
Zfp626 T A 7: 27,517,335 (GRCm39) N105K probably damaging Het
Other mutations in Sh3bp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Sh3bp5 APN 14 31,101,347 (GRCm39) nonsense probably null
IGL02828:Sh3bp5 APN 14 31,156,106 (GRCm39) splice site probably benign
R1925:Sh3bp5 UTSW 14 31,157,880 (GRCm39) missense probably benign
R2511:Sh3bp5 UTSW 14 31,133,586 (GRCm39) missense probably damaging 1.00
R4798:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R4799:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5303:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5306:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5307:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5308:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5400:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5401:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5402:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5422:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5496:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5498:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5500:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5687:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5688:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5724:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5762:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5765:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5862:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5938:Sh3bp5 UTSW 14 31,109,791 (GRCm39) missense possibly damaging 0.65
R5940:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R5941:Sh3bp5 UTSW 14 31,099,452 (GRCm39) missense probably benign 0.06
R6516:Sh3bp5 UTSW 14 31,097,629 (GRCm39) missense possibly damaging 0.84
R6935:Sh3bp5 UTSW 14 31,101,473 (GRCm39) missense probably damaging 0.96
R7309:Sh3bp5 UTSW 14 31,100,246 (GRCm39) missense probably benign 0.21
R8196:Sh3bp5 UTSW 14 31,139,399 (GRCm39) missense probably benign 0.21
R8224:Sh3bp5 UTSW 14 31,099,473 (GRCm39) missense probably damaging 0.97
R8535:Sh3bp5 UTSW 14 31,139,375 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAATGAGCACAGCGTCCC -3'
(R):5'- TGTTGTAATCATGTGTCACCCC -3'

Sequencing Primer
(F):5'- AGCGTCCCACAATACATGAG -3'
(R):5'- ATGTGTCACCCCCTCCATCAG -3'
Posted On 2016-09-01