Incidental Mutation 'R5421:Cadm2'
ID426594
Institutional Source Beutler Lab
Gene Symbol Cadm2
Ensembl Gene ENSMUSG00000064115
Gene Namecell adhesion molecule 2
SynonymsA830029E02Rik, Necl3, 2900078E11Rik, Igsf4d, SynCAM2
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.557) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location66655421-67620908 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 66771627 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 248 (C248*)
Ref Sequence ENSEMBL: ENSMUSP00000134554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114292] [ENSMUST00000120594] [ENSMUST00000120898] [ENSMUST00000128168]
Predicted Effect probably null
Transcript: ENSMUST00000114292
AA Change: C257*
SMART Domains Protein: ENSMUSP00000109931
Gene: ENSMUSG00000064115
AA Change: C257*

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 38 130 2.19e-9 SMART
Pfam:Ig_3 135 216 1.2e-6 PFAM
Pfam:C2-set_2 135 222 6.4e-17 PFAM
Pfam:Ig_2 135 228 1.8e-6 PFAM
Pfam:I-set 136 229 1.3e-7 PFAM
Pfam:C1-set 142 225 1.5e-9 PFAM
IGc2 248 312 2.56e-10 SMART
4.1m 357 375 5.39e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120594
AA Change: C248*
SMART Domains Protein: ENSMUSP00000113500
Gene: ENSMUSG00000064115
AA Change: C248*

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 4.2e-7 PFAM
Pfam:C2-set_2 126 213 1.8e-16 PFAM
Pfam:I-set 127 220 1.5e-7 PFAM
Pfam:C1-set 133 216 7e-10 PFAM
Pfam:ig 133 218 9.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000120898
AA Change: C248*
SMART Domains Protein: ENSMUSP00000113178
Gene: ENSMUSG00000064115
AA Change: C248*

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.2e-6 PFAM
Pfam:C2-set_2 126 213 6.2e-17 PFAM
Pfam:Ig_2 126 219 1.7e-6 PFAM
Pfam:I-set 127 220 1.3e-7 PFAM
Pfam:C1-set 133 216 1.5e-9 PFAM
IGc2 239 303 2.56e-10 SMART
4.1m 348 366 5.39e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000128168
AA Change: C248*
SMART Domains Protein: ENSMUSP00000134554
Gene: ENSMUSG00000064115
AA Change: C248*

DomainStartEndE-ValueType
IG 29 121 2.19e-9 SMART
Pfam:Ig_3 126 207 1.4e-6 PFAM
Pfam:C2-set_2 126 213 7.2e-16 PFAM
Pfam:I-set 127 220 5e-7 PFAM
Pfam:C1-set 133 216 2.2e-9 PFAM
Pfam:ig 133 218 3.6e-8 PFAM
IGc2 239 303 2.56e-10 SMART
low complexity region 319 352 N/A INTRINSIC
4.1m 388 406 5.39e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the synaptic cell adhesion molecule 1 (SynCAM) family which belongs to the immunoglobulin (Ig) superfamily. The encoded protein has three Ig-like domains and a cytosolic protein 4.1 binding site near the C-terminus. Proteins belonging to the protein 4.1 family crosslink spectrin and interact with other cytoskeletal proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice with ubiquitous conditional deletion of the gene do not display any neurological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Cadm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Cadm2 APN 16 66882751 missense probably damaging 1.00
IGL01137:Cadm2 APN 16 66815350 missense probably damaging 1.00
IGL01340:Cadm2 APN 16 66784785 missense possibly damaging 0.62
IGL01406:Cadm2 APN 16 66815304 splice site probably null
IGL02029:Cadm2 APN 16 66747296 missense probably damaging 1.00
IGL02541:Cadm2 APN 16 66882882 missense possibly damaging 0.73
IGL02541:Cadm2 APN 16 66882883 critical splice acceptor site probably null
IGL02952:Cadm2 APN 16 66664452 missense probably damaging 0.99
vitro UTSW 16 66882832 nonsense probably null
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0050:Cadm2 UTSW 16 66953266 splice site probably benign
R0399:Cadm2 UTSW 16 66747339 nonsense probably null
R0883:Cadm2 UTSW 16 66882814 missense probably damaging 1.00
R1035:Cadm2 UTSW 16 66815347 missense probably damaging 1.00
R1539:Cadm2 UTSW 16 66784840 missense probably damaging 1.00
R1889:Cadm2 UTSW 16 66882795 missense probably damaging 1.00
R1898:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R1918:Cadm2 UTSW 16 66747384 splice site probably benign
R2108:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R2570:Cadm2 UTSW 16 66815383 missense probably damaging 1.00
R3878:Cadm2 UTSW 16 66815441 missense probably damaging 1.00
R4093:Cadm2 UTSW 16 66784788 missense possibly damaging 0.94
R4094:Cadm2 UTSW 16 66882797 missense probably damaging 1.00
R5555:Cadm2 UTSW 16 66784815 missense probably damaging 1.00
R6173:Cadm2 UTSW 16 66882841 missense probably benign 0.04
R6188:Cadm2 UTSW 16 66815307 critical splice donor site probably null
R6224:Cadm2 UTSW 16 66664395 missense probably damaging 1.00
R6492:Cadm2 UTSW 16 66784828 missense probably damaging 0.98
R6957:Cadm2 UTSW 16 66812838 missense probably benign 0.02
R7051:Cadm2 UTSW 16 66882879 missense possibly damaging 0.86
R7183:Cadm2 UTSW 16 66882832 nonsense probably null
R7322:Cadm2 UTSW 16 66882846 missense probably damaging 1.00
R7792:Cadm2 UTSW 16 66771637 missense probably benign 0.01
R7882:Cadm2 UTSW 16 66731471 missense probably benign 0.43
R8101:Cadm2 UTSW 16 66812842 missense possibly damaging 0.75
R8166:Cadm2 UTSW 16 66953309 missense probably benign 0.01
R8325:Cadm2 UTSW 16 66815450 missense possibly damaging 0.95
R8496:Cadm2 UTSW 16 66664423 missense probably damaging 1.00
R8746:Cadm2 UTSW 16 66784809 missense probably damaging 0.99
X0026:Cadm2 UTSW 16 66663152 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- CCTCACTGTGCCCAAAATTAGATC -3'
(R):5'- TTGTTAAATTGCACAGATGAGAGGG -3'

Sequencing Primer
(F):5'- CACTGTGCCCAAAATTAGATCATTTG -3'
(R):5'- AGAGGGTAGCAGCCTTCTCTC -3'
Posted On2016-09-01