Incidental Mutation 'R5421:Afdn'
ID426595
Institutional Source Beutler Lab
Gene Symbol Afdn
Ensembl Gene ENSMUSG00000068036
Gene Nameafadin, adherens junction formation factor
SynonymsAfadin, I-afadin, AF6, Mllt4, S-afadin, 5033403D15Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location13760539-13906150 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13832406 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 525 (V525A)
Ref Sequence ENSEMBL: ENSMUSP00000122447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000137708] [ENSMUST00000137784] [ENSMUST00000139666] [ENSMUST00000150848] [ENSMUST00000170827]
AlphaFold Q9QZQ1
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137495
Predicted Effect probably benign
Transcript: ENSMUST00000137708
AA Change: V540A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114485
Gene: ENSMUSG00000068036
AA Change: V540A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1616 1660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137784
AA Change: V540A

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000119153
Gene: ENSMUSG00000068036
AA Change: V540A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 792 898 4.11e-39 SMART
PDZ 1023 1100 8.07e-19 SMART
low complexity region 1316 1325 N/A INTRINSIC
low complexity region 1393 1399 N/A INTRINSIC
coiled coil region 1416 1454 N/A INTRINSIC
coiled coil region 1530 1570 N/A INTRINSIC
low complexity region 1582 1594 N/A INTRINSIC
coiled coil region 1600 1672 N/A INTRINSIC
low complexity region 1699 1713 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139666
AA Change: V540A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000118318
Gene: ENSMUSG00000068036
AA Change: V540A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 425 477 1.24e-5 SMART
DIL 785 891 4.11e-39 SMART
PDZ 1016 1093 8.07e-19 SMART
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1386 1392 N/A INTRINSIC
coiled coil region 1409 1447 N/A INTRINSIC
coiled coil region 1523 1563 N/A INTRINSIC
low complexity region 1575 1587 N/A INTRINSIC
coiled coil region 1593 1665 N/A INTRINSIC
low complexity region 1692 1706 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000150848
AA Change: V525A

PolyPhen 2 Score 0.255 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122447
Gene: ENSMUSG00000068036
AA Change: V525A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000170827
AA Change: V525A

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000128891
Gene: ENSMUSG00000068036
AA Change: V525A

DomainStartEndE-ValueType
RA 39 133 5.88e-29 SMART
coiled coil region 146 186 N/A INTRINSIC
RA 246 348 1.56e-24 SMART
FHA 410 462 1.24e-5 SMART
DIL 770 876 4.11e-39 SMART
PDZ 1001 1078 8.07e-19 SMART
low complexity region 1294 1303 N/A INTRINSIC
low complexity region 1371 1377 N/A INTRINSIC
coiled coil region 1394 1432 N/A INTRINSIC
coiled coil region 1508 1548 N/A INTRINSIC
low complexity region 1560 1572 N/A INTRINSIC
coiled coil region 1578 1650 N/A INTRINSIC
low complexity region 1677 1691 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein involved in signaling and organization of cell junctions during embryogenesis. It has also been identified as the fusion partner of acute lymphoblastic leukemia (ALL-1) gene, involved in acute myeloid leukemias with t(6;11)(q27;q23) translocation. Alternatively spliced transcript variants encoding different isoforms have been described for this gene, however, not all have been fully characterized.[provided by RefSeq, May 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality, abnormal ectoderm development including disrupted cell junctions, and absence of the somites, notochord, allantois, and neural folds. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Afdn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Afdn APN 17 13884628 missense probably damaging 1.00
IGL00784:Afdn APN 17 13849263 splice site probably benign
IGL00971:Afdn APN 17 13852313 splice site probably benign
IGL01403:Afdn APN 17 13903870 missense probably damaging 1.00
IGL01944:Afdn APN 17 13810481 missense probably damaging 1.00
IGL02474:Afdn APN 17 13818229 missense probably damaging 1.00
IGL02615:Afdn APN 17 13825976 missense probably benign 0.00
IGL02664:Afdn APN 17 13852466 splice site probably benign
IGL03036:Afdn APN 17 13888088 missense probably benign 0.12
jubilee UTSW 17 13887986 missense probably damaging 1.00
IGL03134:Afdn UTSW 17 13846286 missense probably benign 0.04
R0112:Afdn UTSW 17 13884637 missense probably damaging 1.00
R0226:Afdn UTSW 17 13899146 missense probably benign 0.00
R0305:Afdn UTSW 17 13888514 splice site probably null
R0310:Afdn UTSW 17 13885508 critical splice donor site probably null
R0711:Afdn UTSW 17 13852436 missense probably damaging 1.00
R0828:Afdn UTSW 17 13903998 missense probably damaging 1.00
R1268:Afdn UTSW 17 13887986 missense probably damaging 1.00
R1317:Afdn UTSW 17 13846273 missense probably benign 0.11
R1386:Afdn UTSW 17 13846536 missense probably damaging 1.00
R1438:Afdn UTSW 17 13855390 missense probably damaging 1.00
R1607:Afdn UTSW 17 13810501 missense probably damaging 1.00
R1819:Afdn UTSW 17 13850848 missense probably damaging 1.00
R1872:Afdn UTSW 17 13881316 missense probably damaging 1.00
R1880:Afdn UTSW 17 13852353 missense possibly damaging 0.84
R2049:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2140:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2142:Afdn UTSW 17 13810433 missense probably damaging 0.96
R2162:Afdn UTSW 17 13896174 missense probably benign 0.01
R2221:Afdn UTSW 17 13883737 splice site probably benign
R2223:Afdn UTSW 17 13883737 splice site probably benign
R2291:Afdn UTSW 17 13888891 missense probably damaging 1.00
R2993:Afdn UTSW 17 13891000 critical splice donor site probably null
R3402:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3403:Afdn UTSW 17 13883914 missense probably damaging 1.00
R3690:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3691:Afdn UTSW 17 13888409 missense probably damaging 1.00
R3764:Afdn UTSW 17 13846589 missense probably benign 0.07
R3832:Afdn UTSW 17 13896174 missense probably benign 0.01
R4002:Afdn UTSW 17 13883917 missense probably damaging 1.00
R4440:Afdn UTSW 17 13850890 missense probably damaging 1.00
R4621:Afdn UTSW 17 13888820 missense probably damaging 1.00
R4935:Afdn UTSW 17 13890966 missense probably benign 0.30
R5279:Afdn UTSW 17 13888952 missense probably damaging 1.00
R5689:Afdn UTSW 17 13855359 missense probably damaging 1.00
R6332:Afdn UTSW 17 13810445 missense possibly damaging 0.92
R6369:Afdn UTSW 17 13835343 nonsense probably null
R6433:Afdn UTSW 17 13881299 missense probably damaging 1.00
R6467:Afdn UTSW 17 13804053 missense probably damaging 1.00
R6500:Afdn UTSW 17 13822372 missense possibly damaging 0.67
R6564:Afdn UTSW 17 13896089 missense probably benign
R6705:Afdn UTSW 17 13888021 missense probably benign 0.01
R6733:Afdn UTSW 17 13823353 missense probably benign 0.39
R6983:Afdn UTSW 17 13881321 missense probably damaging 1.00
R7089:Afdn UTSW 17 13890812 splice site probably null
R7161:Afdn UTSW 17 13888946 missense possibly damaging 0.55
R7175:Afdn UTSW 17 13888607 missense probably damaging 1.00
R7492:Afdn UTSW 17 13848376 critical splice donor site probably null
R7567:Afdn UTSW 17 13888808 missense probably benign 0.19
R7581:Afdn UTSW 17 13849238 missense probably damaging 1.00
R7694:Afdn UTSW 17 13888882 missense probably damaging 0.99
R7722:Afdn UTSW 17 13808969 missense probably benign 0.40
R7794:Afdn UTSW 17 13882433 missense probably damaging 1.00
R8039:Afdn UTSW 17 13899141 missense probably damaging 0.99
R8444:Afdn UTSW 17 13883800 missense probably benign 0.31
R8694:Afdn UTSW 17 13888379 missense probably benign
R8728:Afdn UTSW 17 13898945 missense probably damaging 1.00
R8770:Afdn UTSW 17 13883937 critical splice donor site probably null
R8887:Afdn UTSW 17 13896139 nonsense probably null
R9101:Afdn UTSW 17 13823444 missense probably damaging 0.99
X0060:Afdn UTSW 17 13818170 nonsense probably null
X0064:Afdn UTSW 17 13888027 missense possibly damaging 0.60
Z1088:Afdn UTSW 17 13883780 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTGTGTGCCAAAGTAAATG -3'
(R):5'- AGAAAGTACTAGATTCTGACCTCAG -3'

Sequencing Primer
(F):5'- GAGTACTACCTTGTCAGTTG -3'
(R):5'- TTCTGACCTCAGGACAAAAGG -3'
Posted On2016-09-01