Incidental Mutation 'R5421:Vmn2r110'
ID426596
Institutional Source Beutler Lab
Gene Symbol Vmn2r110
Ensembl Gene ENSMUSG00000091259
Gene Namevomeronasal 2, receptor 110
SynonymsEG224582
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.221) question?
Stock #R5421 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location20573829-20596259 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20583620 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 231 (L231S)
Ref Sequence ENSEMBL: ENSMUSP00000129347 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169559]
AlphaFold E9PWD5
Predicted Effect probably damaging
Transcript: ENSMUST00000169559
AA Change: L231S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000129347
Gene: ENSMUSG00000091259
AA Change: L231S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 83 467 3.1e-33 PFAM
Pfam:NCD3G 510 563 5.2e-22 PFAM
Pfam:7tm_3 594 831 4.2e-51 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Blnk C A 19: 40,968,523 V47F probably damaging Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Vmn2r110
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01774:Vmn2r110 APN 17 20583627 missense probably benign 0.01
IGL01824:Vmn2r110 APN 17 20574667 missense probably benign 0.44
IGL01879:Vmn2r110 APN 17 20573860 missense probably benign 0.01
IGL02168:Vmn2r110 APN 17 20583800 splice site probably benign
IGL02178:Vmn2r110 APN 17 20584444 splice site probably null
IGL02322:Vmn2r110 APN 17 20573935 missense probably damaging 1.00
IGL02323:Vmn2r110 APN 17 20596137 missense probably damaging 0.98
IGL02415:Vmn2r110 APN 17 20583771 missense probably benign 0.03
IGL02491:Vmn2r110 APN 17 20596138 missense probably damaging 0.99
IGL02876:Vmn2r110 APN 17 20574296 missense probably damaging 0.98
IGL03141:Vmn2r110 APN 17 20583714 missense possibly damaging 0.79
IGL03270:Vmn2r110 APN 17 20583516 missense probably benign 0.00
IGL03286:Vmn2r110 APN 17 20584206 missense possibly damaging 0.95
IGL03379:Vmn2r110 APN 17 20583644 missense probably damaging 0.99
PIT4243001:Vmn2r110 UTSW 17 20582117 missense probably benign 0.01
R0040:Vmn2r110 UTSW 17 20596084 missense probably benign 0.10
R0195:Vmn2r110 UTSW 17 20574055 missense probably benign 0.31
R0716:Vmn2r110 UTSW 17 20573903 missense probably damaging 0.99
R1199:Vmn2r110 UTSW 17 20583263 missense probably benign 0.03
R1767:Vmn2r110 UTSW 17 20580578 missense possibly damaging 0.83
R2212:Vmn2r110 UTSW 17 20573947 splice site probably null
R3056:Vmn2r110 UTSW 17 20583098 missense probably damaging 1.00
R4093:Vmn2r110 UTSW 17 20583380 missense possibly damaging 0.83
R4418:Vmn2r110 UTSW 17 20583689 nonsense probably null
R4598:Vmn2r110 UTSW 17 20583767 nonsense probably null
R4754:Vmn2r110 UTSW 17 20596196 missense probably benign 0.00
R5283:Vmn2r110 UTSW 17 20580637 missense probably benign 0.00
R5672:Vmn2r110 UTSW 17 20596232 missense probably benign
R5865:Vmn2r110 UTSW 17 20584295 missense probably benign 0.00
R6642:Vmn2r110 UTSW 17 20583517 missense possibly damaging 0.94
R6799:Vmn2r110 UTSW 17 20583536 missense probably benign
R7167:Vmn2r110 UTSW 17 20574179 missense probably benign 0.01
R7291:Vmn2r110 UTSW 17 20574209 missense probably benign 0.13
R7320:Vmn2r110 UTSW 17 20596054 missense probably benign
R7519:Vmn2r110 UTSW 17 20584262 missense probably benign
R8089:Vmn2r110 UTSW 17 20583545 missense probably benign 0.00
R8234:Vmn2r110 UTSW 17 20584429 missense probably benign 0.12
R8272:Vmn2r110 UTSW 17 20596228 missense probably damaging 0.97
R8307:Vmn2r110 UTSW 17 20583057 missense probably benign 0.00
R8506:Vmn2r110 UTSW 17 20584365 missense probably benign 0.00
R8516:Vmn2r110 UTSW 17 20574613 missense probably damaging 1.00
R8555:Vmn2r110 UTSW 17 20584356 missense probably damaging 0.97
R8691:Vmn2r110 UTSW 17 20583142 missense probably benign 0.19
R8859:Vmn2r110 UTSW 17 20574298 missense probably damaging 0.99
R8935:Vmn2r110 UTSW 17 20583695 missense probably benign 0.40
R8986:Vmn2r110 UTSW 17 20583561 missense probably damaging 0.97
R9012:Vmn2r110 UTSW 17 20583365 missense probably damaging 1.00
R9101:Vmn2r110 UTSW 17 20574209 missense
Z1088:Vmn2r110 UTSW 17 20583680 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTGTCAACAATCTTTGCC -3'
(R):5'- TGCTTCAGGAATGGAATTTTGCATG -3'

Sequencing Primer
(F):5'- GCCCAATATTTCTCATTAGACCTGTG -3'
(R):5'- ACTTGGTCCAGCTTTCCTTTGG -3'
Posted On2016-09-01