Mutagenetix > Incidental Mutations

Incidental Mutation 'R5421:Blnk'

426605

Institutional Source

Beutler Lab

Gene Symbol

Blnk

Ensembl Gene

ENSMUSG00000061132

Gene Name

B cell linker

Synonyms

BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.148) question?

Stock #

R5421 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40928927-40994535 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 40968523 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 47 (V47F)

Ref Sequence

ENSEMBL: ENSMUSP00000112473 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]

AlphaFold

Q9QUN3

Predicted Effect

probably damaging
Transcript: ENSMUST00000054769
AA Change: V47F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: V47F

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	345	436	3.07e-19	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000117695
AA Change: V47F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: V47F

Domain	Start	End	E-Value	Type
Blast:SH2	139	180	6e-8	BLAST
low complexity region	235	247	N/A	INTRINSIC
low complexity region	251	266	N/A	INTRINSIC
SH2	342	433	3.07e-19	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134568

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrb1	A	T	15: 74,550,027	Q882L	probably damaging	Het
Afdn	T	C	17: 13,832,406	V525A	probably benign	Het
AI987944	T	C	7: 41,374,776	T263A	probably benign	Het
Aldh1l2	T	C	10: 83,527,407	S31G	probably damaging	Het
Asxl1	T	C	2: 153,399,584	S685P	probably benign	Het
BC005561	A	T	5: 104,518,395	N261I	probably benign	Het
Bmp4	T	A	14: 46,385,898	M64L	probably damaging	Het
Bmpr2	T	A	1: 59,870,418	V1017E	possibly damaging	Het
C1ra	C	T	6: 124,522,790	P645L	probably benign	Het
Cadm2	A	T	16: 66,771,627	C248*	probably null	Het
Cd163l1	T	C	7: 140,223,900	L337P	probably damaging	Het
Cdk6	T	C	5: 3,473,120	V180A	probably damaging	Het
Colec12	A	T	18: 9,858,580	R454S	probably damaging	Het
Dennd3	T	C	15: 73,567,115	S1111P	probably benign	Het
Dmxl1	T	C	18: 49,863,119		probably null	Het
Dnah2	G	A	11: 69,435,636	T3613I	probably damaging	Het
Elp6	A	G	9: 110,314,064	Q115R	probably benign	Het
Enpp1	A	G	10: 24,669,757	Y262H	probably damaging	Het
Far2	A	G	6: 148,146,192		probably null	Het
Flnb	C	T	14: 7,926,494	T1846I	probably damaging	Het
Folr2	C	T	7: 101,840,644	R139H	probably benign	Het
Fxn	A	T	19: 24,277,285		probably null	Het
Galnt13	A	C	2: 54,857,896	N263T	probably damaging	Het
Gje1	G	A	10: 14,716,684	S118L	probably damaging	Het
Htr5a	G	T	5: 27,850,987	W325C	possibly damaging	Het
Itga4	T	A	2: 79,316,041	Y772*	probably null	Het
Kif12	T	C	4: 63,171,428	S59G	probably benign	Het
Kifc3	C	T	8: 95,109,845	R96Q	probably damaging	Het
Klrd1	T	C	6: 129,598,443	Y191H	probably damaging	Het
Ndst3	A	T	3: 123,634,359		probably null	Het
Nek1	A	C	8: 61,006,677	R6S	possibly damaging	Het
Olfr142	G	A	2: 90,252,745	T81I	probably benign	Het
Olfr421-ps1	C	T	1: 174,152,295	R260*	probably null	Het
Olfr493	G	C	7: 108,346,975	A2G	probably benign	Het
Palld	C	T	8: 61,516,550	E1005K	probably damaging	Het
Ppp2r1a	T	A	17: 20,956,706	Y169N	probably benign	Het
Rad50	T	C	11: 53,674,946	D960G	probably benign	Het
Rad51ap2	A	T	12: 11,459,367	K915*	probably null	Het
Rasal2	T	C	1: 157,299,141	K109R	probably benign	Het
Rc3h1	G	A	1: 160,951,830		probably null	Het
Rnf6	C	T	5: 146,210,529	V560I	probably benign	Het
Samd8	A	G	14: 21,792,495	D295G	probably damaging	Het
Serpinb2	T	C	1: 107,523,851	Y245H	probably damaging	Het
Sh3bp5	C	A	14: 31,377,495	R265L	probably benign	Het
Slc28a3	A	T	13: 58,574,265	F268L	possibly damaging	Het
Slc7a14	T	C	3: 31,224,197	T420A	probably damaging	Het
Speer4f2	A	T	5: 17,374,358	T52S	possibly damaging	Het
Spta1	A	G	1: 174,215,529	N1414D	probably damaging	Het
Sptbn5	A	G	2: 120,080,780		noncoding transcript	Het
Syt9	T	C	7: 107,425,356	V152A	probably benign	Het
Tln1	G	A	4: 43,533,609	A2315V	possibly damaging	Het
Tox	C	A	4: 6,842,409	M40I	possibly damaging	Het
Ucp1	G	A	8: 83,290,691	A37T	probably benign	Het
Vapa	A	G	17: 65,595,036	V33A	possibly damaging	Het
Vmn2r110	A	G	17: 20,583,620	L231S	probably damaging	Het
Vmn2r15	C	T	5: 109,286,535	A768T	probably damaging	Het
Vmn2r86	T	C	10: 130,446,936	T604A	probably benign	Het
Vps51	T	G	19: 6,071,033	E283D	probably benign	Het
Wnk1	A	G	6: 119,952,818	V1246A	probably damaging	Het
Wwc1	T	G	11: 35,876,063	D455A	possibly damaging	Het
Wwc1	C	T	11: 35,910,296	E105K	possibly damaging	Het
Zfp426	G	A	9: 20,470,719	A309V	probably damaging	Het
Zfp626	T	A	7: 27,817,910	N105K	probably damaging	Het

Other mutations in Blnk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Blnk	APN	19	40934446	missense	probably benign	0.15
IGL01286:Blnk	APN	19	40934506	missense	probably benign	0.00
IGL02090:Blnk	APN	19	40934485	missense	probably benign	0.38
IGL02814:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL02831:Blnk	APN	19	40962429	missense	probably damaging	1.00
IGL03024:Blnk	APN	19	40994002	splice site	probably benign
Augen	UTSW	19	40929291	missense	probably damaging	1.00
Blick	UTSW	19	40934459	missense	probably damaging	1.00
busy	UTSW	19	40952391	nonsense	probably null
There	UTSW	19	40952390	missense	possibly damaging	0.94
IGL02988:Blnk	UTSW	19	40929216	missense	probably damaging	1.00
R0140:Blnk	UTSW	19	40940224	missense	probably damaging	0.99
R0671:Blnk	UTSW	19	40937667	nonsense	probably null
R1617:Blnk	UTSW	19	40962363	missense	probably benign
R1638:Blnk	UTSW	19	40937678	missense	probably benign
R1803:Blnk	UTSW	19	40952377	missense	probably damaging	0.96
R1970:Blnk	UTSW	19	40940165	splice site	probably benign
R2880:Blnk	UTSW	19	40962455	missense	probably damaging	1.00
R2980:Blnk	UTSW	19	40962350	missense	probably damaging	1.00
R5987:Blnk	UTSW	19	40929289	missense	possibly damaging	0.95
R6321:Blnk	UTSW	19	40934459	missense	probably damaging	1.00
R6703:Blnk	UTSW	19	40962506	splice site	probably null
R6970:Blnk	UTSW	19	40962377	missense	probably damaging	0.99
R7101:Blnk	UTSW	19	40972638	missense	probably benign	0.01
R7432:Blnk	UTSW	19	40959857	nonsense	probably null
R7560:Blnk	UTSW	19	40952390	missense	possibly damaging	0.94
R7797:Blnk	UTSW	19	40959788	missense	possibly damaging	0.51
R8287:Blnk	UTSW	19	40929291	missense	probably damaging	1.00
R8473:Blnk	UTSW	19	40952410	missense	possibly damaging	0.81
R8798:Blnk	UTSW	19	40962351	missense	probably damaging	1.00
R9094:Blnk	UTSW	19	40994039	missense	probably benign	0.39
R9139:Blnk	UTSW	19	40934518	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GAGTACAGCATATTTCCCTCCC -3'
(R):5'- TGTGCACTGTGGAGAATACTG -3'

Sequencing Primer
(F):5'- ATGGTAGCTCCCAACCATCTGTAATG -3'
(R):5'- CACTGTGGAGAATACTGGCTTC -3'

Posted On

2016-09-01