Incidental Mutation 'R5421:Blnk'
ID 426605
Institutional Source Beutler Lab
Gene Symbol Blnk
Ensembl Gene ENSMUSG00000061132
Gene Name B cell linker
Synonyms BASH, Bca, SLP-65, BCA, BLNK, Ly-57, Ly57
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.148) question?
Stock # R5421 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 40928927-40994535 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 40968523 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Phenylalanine at position 47 (V47F)
Ref Sequence ENSEMBL: ENSMUSP00000112473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054769] [ENSMUST00000117695]
AlphaFold Q9QUN3
Predicted Effect probably damaging
Transcript: ENSMUST00000054769
AA Change: V47F

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000057844
Gene: ENSMUSG00000061132
AA Change: V47F

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 345 436 3.07e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000117695
AA Change: V47F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112473
Gene: ENSMUSG00000061132
AA Change: V47F

DomainStartEndE-ValueType
Blast:SH2 139 180 6e-8 BLAST
low complexity region 235 247 N/A INTRINSIC
low complexity region 251 266 N/A INTRINSIC
SH2 342 433 3.07e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134568
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic linker or adaptor protein that plays a critical role in B cell development. This protein bridges B cell receptor-associated kinase activation with downstream signaling pathways, thereby affecting various biological functions. The phosphorylation of five tyrosine residues is necessary for this protein to nucleate distinct signaling effectors following B cell receptor activation. Mutations in this gene cause hypoglobulinemia and absent B cells, a disease in which the pro- to pre-B-cell transition is developmentally blocked. Deficiency in this protein has also been shown in some cases of pre-B acute lymphoblastic leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for targeted null mutations exhibit a partial block in pre-B cell development, a lack of B1 B cells, reduced numbers of mature B cells, lower IgM and IgG3 serum levels, poor IgM immune responses, and a high incidence of pre-B cell lymphoma. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 A T 15: 74,550,027 Q882L probably damaging Het
Afdn T C 17: 13,832,406 V525A probably benign Het
AI987944 T C 7: 41,374,776 T263A probably benign Het
Aldh1l2 T C 10: 83,527,407 S31G probably damaging Het
Asxl1 T C 2: 153,399,584 S685P probably benign Het
BC005561 A T 5: 104,518,395 N261I probably benign Het
Bmp4 T A 14: 46,385,898 M64L probably damaging Het
Bmpr2 T A 1: 59,870,418 V1017E possibly damaging Het
C1ra C T 6: 124,522,790 P645L probably benign Het
Cadm2 A T 16: 66,771,627 C248* probably null Het
Cd163l1 T C 7: 140,223,900 L337P probably damaging Het
Cdk6 T C 5: 3,473,120 V180A probably damaging Het
Colec12 A T 18: 9,858,580 R454S probably damaging Het
Dennd3 T C 15: 73,567,115 S1111P probably benign Het
Dmxl1 T C 18: 49,863,119 probably null Het
Dnah2 G A 11: 69,435,636 T3613I probably damaging Het
Elp6 A G 9: 110,314,064 Q115R probably benign Het
Enpp1 A G 10: 24,669,757 Y262H probably damaging Het
Far2 A G 6: 148,146,192 probably null Het
Flnb C T 14: 7,926,494 T1846I probably damaging Het
Folr2 C T 7: 101,840,644 R139H probably benign Het
Fxn A T 19: 24,277,285 probably null Het
Galnt13 A C 2: 54,857,896 N263T probably damaging Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Htr5a G T 5: 27,850,987 W325C possibly damaging Het
Itga4 T A 2: 79,316,041 Y772* probably null Het
Kif12 T C 4: 63,171,428 S59G probably benign Het
Kifc3 C T 8: 95,109,845 R96Q probably damaging Het
Klrd1 T C 6: 129,598,443 Y191H probably damaging Het
Ndst3 A T 3: 123,634,359 probably null Het
Nek1 A C 8: 61,006,677 R6S possibly damaging Het
Olfr142 G A 2: 90,252,745 T81I probably benign Het
Olfr421-ps1 C T 1: 174,152,295 R260* probably null Het
Olfr493 G C 7: 108,346,975 A2G probably benign Het
Palld C T 8: 61,516,550 E1005K probably damaging Het
Ppp2r1a T A 17: 20,956,706 Y169N probably benign Het
Rad50 T C 11: 53,674,946 D960G probably benign Het
Rad51ap2 A T 12: 11,459,367 K915* probably null Het
Rasal2 T C 1: 157,299,141 K109R probably benign Het
Rc3h1 G A 1: 160,951,830 probably null Het
Rnf6 C T 5: 146,210,529 V560I probably benign Het
Samd8 A G 14: 21,792,495 D295G probably damaging Het
Serpinb2 T C 1: 107,523,851 Y245H probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc28a3 A T 13: 58,574,265 F268L possibly damaging Het
Slc7a14 T C 3: 31,224,197 T420A probably damaging Het
Speer4f2 A T 5: 17,374,358 T52S possibly damaging Het
Spta1 A G 1: 174,215,529 N1414D probably damaging Het
Sptbn5 A G 2: 120,080,780 noncoding transcript Het
Syt9 T C 7: 107,425,356 V152A probably benign Het
Tln1 G A 4: 43,533,609 A2315V possibly damaging Het
Tox C A 4: 6,842,409 M40I possibly damaging Het
Ucp1 G A 8: 83,290,691 A37T probably benign Het
Vapa A G 17: 65,595,036 V33A possibly damaging Het
Vmn2r110 A G 17: 20,583,620 L231S probably damaging Het
Vmn2r15 C T 5: 109,286,535 A768T probably damaging Het
Vmn2r86 T C 10: 130,446,936 T604A probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Wnk1 A G 6: 119,952,818 V1246A probably damaging Het
Wwc1 T G 11: 35,876,063 D455A possibly damaging Het
Wwc1 C T 11: 35,910,296 E105K possibly damaging Het
Zfp426 G A 9: 20,470,719 A309V probably damaging Het
Zfp626 T A 7: 27,817,910 N105K probably damaging Het
Other mutations in Blnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00780:Blnk APN 19 40934446 missense probably benign 0.15
IGL01286:Blnk APN 19 40934506 missense probably benign 0.00
IGL02090:Blnk APN 19 40934485 missense probably benign 0.38
IGL02814:Blnk APN 19 40962429 missense probably damaging 1.00
IGL02831:Blnk APN 19 40962429 missense probably damaging 1.00
IGL03024:Blnk APN 19 40994002 splice site probably benign
Augen UTSW 19 40929291 missense probably damaging 1.00
Blick UTSW 19 40934459 missense probably damaging 1.00
busy UTSW 19 40952391 nonsense probably null
There UTSW 19 40952390 missense possibly damaging 0.94
IGL02988:Blnk UTSW 19 40929216 missense probably damaging 1.00
R0140:Blnk UTSW 19 40940224 missense probably damaging 0.99
R0671:Blnk UTSW 19 40937667 nonsense probably null
R1617:Blnk UTSW 19 40962363 missense probably benign
R1638:Blnk UTSW 19 40937678 missense probably benign
R1803:Blnk UTSW 19 40952377 missense probably damaging 0.96
R1970:Blnk UTSW 19 40940165 splice site probably benign
R2880:Blnk UTSW 19 40962455 missense probably damaging 1.00
R2980:Blnk UTSW 19 40962350 missense probably damaging 1.00
R5987:Blnk UTSW 19 40929289 missense possibly damaging 0.95
R6321:Blnk UTSW 19 40934459 missense probably damaging 1.00
R6703:Blnk UTSW 19 40962506 splice site probably null
R6970:Blnk UTSW 19 40962377 missense probably damaging 0.99
R7101:Blnk UTSW 19 40972638 missense probably benign 0.01
R7432:Blnk UTSW 19 40959857 nonsense probably null
R7560:Blnk UTSW 19 40952390 missense possibly damaging 0.94
R7797:Blnk UTSW 19 40959788 missense possibly damaging 0.51
R8287:Blnk UTSW 19 40929291 missense probably damaging 1.00
R8473:Blnk UTSW 19 40952410 missense possibly damaging 0.81
R8798:Blnk UTSW 19 40962351 missense probably damaging 1.00
R9094:Blnk UTSW 19 40994039 missense probably benign 0.39
R9139:Blnk UTSW 19 40934518 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAGTACAGCATATTTCCCTCCC -3'
(R):5'- TGTGCACTGTGGAGAATACTG -3'

Sequencing Primer
(F):5'- ATGGTAGCTCCCAACCATCTGTAATG -3'
(R):5'- CACTGTGGAGAATACTGGCTTC -3'
Posted On 2016-09-01