Incidental Mutation 'R5422:Elf3'
ID426611
Institutional Source Beutler Lab
Gene Symbol Elf3
Ensembl Gene ENSMUSG00000003051
Gene NameE74-like factor 3
SynonymsESX, jen, ESE-1
MMRRC Submission 042846-MU
Accession Numbers

Ncbi RefSeq: NM_001163131.1, NM_007921.3; MGI:1101781

Is this an essential gene? Probably essential (E-score: 0.830) question?
Stock #R5422 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135253575-135258568 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 135255040 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 316 (E316K)
Ref Sequence ENSEMBL: ENSMUSP00000003135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003135] [ENSMUST00000185752]
PDB Structure
Crystal structure of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-beta receptor promoter DNA [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000003135
AA Change: E316K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000003135
Gene: ENSMUSG00000003051
AA Change: E316K

DomainStartEndE-ValueType
SAM_PNT 67 151 6.32e-30 SMART
low complexity region 230 241 N/A INTRINSIC
AT_hook 264 276 1.29e0 SMART
ETS 292 379 6.11e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180981
Predicted Effect possibly damaging
Transcript: ENSMUST00000185752
AA Change: E296K

PolyPhen 2 Score 0.810 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000139769
Gene: ENSMUSG00000003051
AA Change: E296K

DomainStartEndE-ValueType
SAM_PNT 47 131 1.36e-29 SMART
low complexity region 210 221 N/A INTRINSIC
AT_hook 244 256 1.29e0 SMART
ETS 272 359 6.11e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188895
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype Strain: 2662485
Lethality: D11-D21
PHENOTYPE: About one third of mice homozygous for a reporter allele die at E11.5; over half of those born develop a wasted phenotype, lethargy and watery diarrhea and die during the first few weeks of life exhibiting dysmorphogenesis and altered differentiation of small intestinal epithelium. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,698,974 S1219G probably benign Het
Adgrg5 T A 8: 94,933,952 I73N probably damaging Het
Agmat C A 4: 141,755,833 H193N probably damaging Het
Ambn T C 5: 88,464,511 probably null Het
Atp8b5 T A 4: 43,366,644 C803S probably benign Het
BC005561 T C 5: 104,519,646 I678T probably damaging Het
Btaf1 A T 19: 36,951,107 R109S probably benign Het
Btnl6 C T 17: 34,514,107 G261R possibly damaging Het
Cd163l1 A T 7: 140,224,155 H422L probably benign Het
Clk3 A G 9: 57,765,438 V27A probably benign Het
Clu A G 14: 65,975,602 S146G probably damaging Het
Cyp2w1 T C 5: 139,352,773 F43L probably benign Het
Epha5 A T 5: 84,331,490 D218E probably damaging Het
Ereg T C 5: 91,074,807 probably null Het
Ewsr1 A G 11: 5,080,668 probably benign Het
Fat4 A G 3: 38,887,245 I96V possibly damaging Het
Fgl2 T G 5: 21,375,810 N383K probably damaging Het
Fkbp11 A T 15: 98,728,108 probably null Het
Fn3k C A 11: 121,450,122 P201Q probably damaging Het
Fsip2 A G 2: 82,982,228 I2964V probably benign Het
Gbx1 C T 5: 24,504,669 V393I possibly damaging Het
Gch1 C T 14: 47,157,449 A187T probably damaging Het
Ghdc C A 11: 100,769,194 K242N probably benign Het
Ghrhr A G 6: 55,388,203 H394R probably benign Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,465,228 S236R probably benign Het
Kcnj5 A G 9: 32,317,705 Y66H probably benign Het
Kif15 T A 9: 122,984,889 probably null Het
Magi3 C T 3: 104,051,368 C467Y probably damaging Het
Map7 G T 10: 20,266,766 V303F probably damaging Het
Mapk11 A G 15: 89,146,285 L135P probably damaging Het
Mapkapk5 T A 5: 121,531,722 probably null Het
Myh7b A C 2: 155,631,034 Q1405P probably damaging Het
Nalcn A T 14: 123,515,365 I328N probably damaging Het
Nprl2 C A 9: 107,543,597 R144S probably benign Het
Ogfr G T 2: 180,595,274 D551Y possibly damaging Het
Ogfr A T 2: 180,595,275 D551V probably benign Het
Olfr250 A T 9: 38,367,974 T143S probably benign Het
Olfr524 A T 7: 140,202,392 V126E probably damaging Het
Parp14 T C 16: 35,866,175 K101E probably benign Het
Pcdhb16 A T 18: 37,479,867 T627S probably damaging Het
Pdzrn4 G A 15: 92,677,621 G303S probably benign Het
Plcl1 A T 1: 55,697,384 Y628F probably benign Het
Ptpn9 T A 9: 57,033,157 W194R probably damaging Het
Ranbp9 A T 13: 43,419,626 M474K probably benign Het
Rasgef1a T A 6: 118,088,134 F370Y probably damaging Het
Rassf5 C A 1: 131,181,174 R218L possibly damaging Het
Serpine2 C A 1: 79,816,875 V114L probably benign Het
Serpine2 T C 1: 79,821,489 Y16C probably benign Het
Sgms1 G T 19: 32,159,832 N111K probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tbc1d17 A T 7: 44,848,868 M1K probably null Het
Tcf12 A T 9: 71,869,038 H403Q probably damaging Het
Thsd7b T C 1: 129,921,334 S928P probably benign Het
Tjp1 A T 7: 65,302,967 F1540I probably damaging Het
Tph2 T A 10: 115,079,764 D457V possibly damaging Het
Usp9y T C Y: 1,314,676 I2112V probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp335 T C 2: 164,907,730 K249R probably damaging Het
Zfp54 C A 17: 21,434,526 S427R probably benign Het
Zfp607b A G 7: 27,702,388 T90A probably benign Het
Other mutations in Elf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02141:Elf3 APN 1 135257707 missense possibly damaging 0.94
IGL02470:Elf3 APN 1 135255012 missense probably damaging 1.00
IGL03018:Elf3 APN 1 135256065 missense possibly damaging 0.62
IGL03252:Elf3 APN 1 135254953 missense probably damaging 1.00
P0026:Elf3 UTSW 1 135255973 critical splice donor site probably null
R0087:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R1842:Elf3 UTSW 1 135256793 missense possibly damaging 0.65
R1897:Elf3 UTSW 1 135257137 missense probably damaging 1.00
R2081:Elf3 UTSW 1 135257076 missense probably benign 0.12
R4049:Elf3 UTSW 1 135254277 missense probably benign 0.21
R4467:Elf3 UTSW 1 135256844 missense probably damaging 1.00
R4630:Elf3 UTSW 1 135256740 intron probably benign
R4715:Elf3 UTSW 1 135257752 missense probably damaging 1.00
R4923:Elf3 UTSW 1 135256735 intron probably benign
R5226:Elf3 UTSW 1 135257239 missense probably benign 0.07
R5706:Elf3 UTSW 1 135256482 missense probably benign 0.01
R7115:Elf3 UTSW 1 135257118 missense probably damaging 1.00
R7644:Elf3 UTSW 1 135256506 missense possibly damaging 0.89
R7855:Elf3 UTSW 1 135254352 missense probably damaging 1.00
R7938:Elf3 UTSW 1 135254352 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTCTTGTGAAACCTAGCG -3'
(R):5'- GGAAGCAGCCACTATAGCAATC -3'

Sequencing Primer
(F):5'- CGGAAGCCAGTAGAGCCC -3'
(R):5'- GGACATTTCATATACTCCCATATGC -3'
Posted On2016-09-01