Incidental Mutation 'R5422:Fat4'
ID426620
Institutional Source Beutler Lab
Gene Symbol Fat4
Ensembl Gene ENSMUSG00000046743
Gene NameFAT atypical cadherin 4
Synonyms6030410K14Rik
MMRRC Submission 042846-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5422 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location38886940-39011985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 38887245 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 96 (I96V)
Ref Sequence ENSEMBL: ENSMUSP00000061836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061260]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061260
AA Change: I96V

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000061836
Gene: ENSMUSG00000046743
AA Change: I96V

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
CA 60 133 4.09e-7 SMART
CA 157 248 4.51e-18 SMART
CA 272 351 7.66e-30 SMART
CA 380 473 2.55e-17 SMART
CA 497 580 8.27e-26 SMART
CA 605 687 6.46e-28 SMART
CA 711 791 1e-24 SMART
CA 815 891 3.78e-20 SMART
CA 915 994 8.6e-24 SMART
CA 1018 1098 7.09e-25 SMART
CA 1122 1208 6.78e-22 SMART
CA 1232 1313 2.63e-28 SMART
CA 1337 1418 7.25e-31 SMART
CA 1442 1527 4.58e-19 SMART
CA 1550 1629 4.52e-9 SMART
CA 1651 1738 1.3e-9 SMART
CA 1762 1839 2.01e-24 SMART
CA 1863 1942 3.11e-21 SMART
CA 1966 2049 5.85e-26 SMART
CA 2072 2152 1.88e-29 SMART
CA 2176 2257 3.06e-29 SMART
CA 2282 2362 2.61e-23 SMART
CA 2386 2466 2.99e-32 SMART
CA 2490 2568 9.92e-6 SMART
CA 2588 2669 6.58e-20 SMART
CA 2692 2773 7.25e-31 SMART
CA 2796 2872 1.69e-22 SMART
CA 2896 2983 3.16e-22 SMART
CA 3007 3089 1.01e-15 SMART
CA 3113 3194 1.25e-25 SMART
CA 3218 3298 7e-15 SMART
CA 3322 3405 3.96e-14 SMART
CA 3428 3510 3.41e-27 SMART
CA 3532 3614 5.64e-19 SMART
EGF 3807 3862 1.78e-2 SMART
EGF_CA 3864 3900 2.36e-16 SMART
EGF_CA 3902 3938 7.99e-14 SMART
EGF 3943 3976 1.24e-1 SMART
LamG 3996 4144 4.08e-19 SMART
EGF 4167 4200 5.88e-3 SMART
LamG 4244 4375 1.76e-23 SMART
EGF 4430 4464 1.41e-5 SMART
low complexity region 4514 4526 N/A INTRINSIC
low complexity region 4533 4550 N/A INTRINSIC
low complexity region 4840 4849 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129182
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153659
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protocadherin family. This gene may play a role in regulating planar cell polarity (PCP). Studies in mice suggest that loss of PCP signaling may cause cystic kidney disease, and mutations in this gene have been associated with Van Maldergem Syndrome 2. Alternatively spliced transcript variants have been noted for this gene. [provided by RefSeq, Mar 2014]
PHENOTYPE: Homozygous inactivation of this gene leads to neonatal lethality, reduced birth body size, curly tails, kyphosis, small lungs, renal cysts, and defects in sternum and vertebrae morphology, neural tube width, cochlear elongation, stereocilia orientation, kidney development, and intestinal elongation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,698,974 S1219G probably benign Het
Adgrg5 T A 8: 94,933,952 I73N probably damaging Het
Agmat C A 4: 141,755,833 H193N probably damaging Het
Ambn T C 5: 88,464,511 probably null Het
Atp8b5 T A 4: 43,366,644 C803S probably benign Het
BC005561 T C 5: 104,519,646 I678T probably damaging Het
Btaf1 A T 19: 36,951,107 R109S probably benign Het
Btnl6 C T 17: 34,514,107 G261R possibly damaging Het
Cd163l1 A T 7: 140,224,155 H422L probably benign Het
Clk3 A G 9: 57,765,438 V27A probably benign Het
Clu A G 14: 65,975,602 S146G probably damaging Het
Cyp2w1 T C 5: 139,352,773 F43L probably benign Het
Elf3 C T 1: 135,255,040 E316K probably damaging Het
Epha5 A T 5: 84,331,490 D218E probably damaging Het
Ereg T C 5: 91,074,807 probably null Het
Ewsr1 A G 11: 5,080,668 probably benign Het
Fgl2 T G 5: 21,375,810 N383K probably damaging Het
Fkbp11 A T 15: 98,728,108 probably null Het
Fn3k C A 11: 121,450,122 P201Q probably damaging Het
Fsip2 A G 2: 82,982,228 I2964V probably benign Het
Gbx1 C T 5: 24,504,669 V393I possibly damaging Het
Gch1 C T 14: 47,157,449 A187T probably damaging Het
Ghdc C A 11: 100,769,194 K242N probably benign Het
Ghrhr A G 6: 55,388,203 H394R probably benign Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,465,228 S236R probably benign Het
Kcnj5 A G 9: 32,317,705 Y66H probably benign Het
Kif15 T A 9: 122,984,889 probably null Het
Magi3 C T 3: 104,051,368 C467Y probably damaging Het
Map7 G T 10: 20,266,766 V303F probably damaging Het
Mapk11 A G 15: 89,146,285 L135P probably damaging Het
Mapkapk5 T A 5: 121,531,722 probably null Het
Myh7b A C 2: 155,631,034 Q1405P probably damaging Het
Nalcn A T 14: 123,515,365 I328N probably damaging Het
Nprl2 C A 9: 107,543,597 R144S probably benign Het
Ogfr G T 2: 180,595,274 D551Y possibly damaging Het
Ogfr A T 2: 180,595,275 D551V probably benign Het
Olfr250 A T 9: 38,367,974 T143S probably benign Het
Olfr524 A T 7: 140,202,392 V126E probably damaging Het
Parp14 T C 16: 35,866,175 K101E probably benign Het
Pcdhb16 A T 18: 37,479,867 T627S probably damaging Het
Pdzrn4 G A 15: 92,677,621 G303S probably benign Het
Plcl1 A T 1: 55,697,384 Y628F probably benign Het
Ptpn9 T A 9: 57,033,157 W194R probably damaging Het
Ranbp9 A T 13: 43,419,626 M474K probably benign Het
Rasgef1a T A 6: 118,088,134 F370Y probably damaging Het
Rassf5 C A 1: 131,181,174 R218L possibly damaging Het
Serpine2 C A 1: 79,816,875 V114L probably benign Het
Serpine2 T C 1: 79,821,489 Y16C probably benign Het
Sgms1 G T 19: 32,159,832 N111K probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tbc1d17 A T 7: 44,848,868 M1K probably null Het
Tcf12 A T 9: 71,869,038 H403Q probably damaging Het
Thsd7b T C 1: 129,921,334 S928P probably benign Het
Tjp1 A T 7: 65,302,967 F1540I probably damaging Het
Tph2 T A 10: 115,079,764 D457V possibly damaging Het
Usp9y T C Y: 1,314,676 I2112V probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp335 T C 2: 164,907,730 K249R probably damaging Het
Zfp54 C A 17: 21,434,526 S427R probably benign Het
Zfp607b A G 7: 27,702,388 T90A probably benign Het
Other mutations in Fat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Fat4 APN 3 38982249 missense probably damaging 1.00
IGL00509:Fat4 APN 3 38889039 missense probably damaging 1.00
IGL00698:Fat4 APN 3 38981145 missense probably benign 0.17
IGL00934:Fat4 APN 3 38890673 missense probably damaging 1.00
IGL01063:Fat4 APN 3 38890579 missense possibly damaging 0.80
IGL01123:Fat4 APN 3 38957269 missense probably benign 0.00
IGL01313:Fat4 APN 3 39007201 missense possibly damaging 0.53
IGL01328:Fat4 APN 3 38980658 missense probably damaging 1.00
IGL01328:Fat4 APN 3 38889991 missense probably damaging 1.00
IGL01374:Fat4 APN 3 38887498 missense probably damaging 1.00
IGL01412:Fat4 APN 3 38891181 missense probably benign 0.09
IGL01472:Fat4 APN 3 38888070 missense probably damaging 1.00
IGL01514:Fat4 APN 3 38949534 missense possibly damaging 0.89
IGL01548:Fat4 APN 3 39009257 missense probably damaging 1.00
IGL01548:Fat4 APN 3 38887758 missense probably damaging 0.99
IGL01576:Fat4 APN 3 38888947 missense probably damaging 1.00
IGL01591:Fat4 APN 3 39010375 nonsense probably null
IGL01626:Fat4 APN 3 38951032 missense probably damaging 1.00
IGL01746:Fat4 APN 3 38991731 nonsense probably null
IGL01800:Fat4 APN 3 38981729 missense probably damaging 0.99
IGL01815:Fat4 APN 3 38888773 missense probably damaging 1.00
IGL01863:Fat4 APN 3 38970619 splice site probably benign
IGL01917:Fat4 APN 3 38889730 missense possibly damaging 0.89
IGL01936:Fat4 APN 3 38979774 missense probably benign 0.10
IGL02060:Fat4 APN 3 39010271 missense probably damaging 1.00
IGL02103:Fat4 APN 3 38889199 missense probably damaging 0.97
IGL02119:Fat4 APN 3 38982939 missense probably benign 0.10
IGL02124:Fat4 APN 3 38888404 missense probably damaging 1.00
IGL02164:Fat4 APN 3 38996205 critical splice donor site probably null
IGL02182:Fat4 APN 3 38890546 missense probably damaging 1.00
IGL02207:Fat4 APN 3 38951263 missense probably benign 0.16
IGL02210:Fat4 APN 3 38891853 missense probably benign 0.01
IGL02257:Fat4 APN 3 39001139 missense probably benign 0.09
IGL02271:Fat4 APN 3 38979919 missense probably benign 0.18
IGL02305:Fat4 APN 3 39009988 missense probably damaging 1.00
IGL02314:Fat4 APN 3 38887630 missense probably damaging 1.00
IGL02455:Fat4 APN 3 38951131 missense possibly damaging 0.48
IGL02468:Fat4 APN 3 38983046 missense probably benign
IGL02478:Fat4 APN 3 38888215 missense probably damaging 1.00
IGL02480:Fat4 APN 3 39010430 missense probably damaging 1.00
IGL02487:Fat4 APN 3 38887245 missense probably damaging 1.00
IGL02632:Fat4 APN 3 39002764 missense probably benign 0.04
IGL02665:Fat4 APN 3 39002836 missense probably benign 0.08
IGL02674:Fat4 APN 3 38983337 missense probably benign 0.35
IGL02692:Fat4 APN 3 38951086 missense probably damaging 1.00
IGL02710:Fat4 APN 3 38890595 missense probably damaging 1.00
IGL02803:Fat4 APN 3 38889295 missense probably damaging 1.00
IGL02834:Fat4 APN 3 38956744 missense probably damaging 1.00
IGL02891:Fat4 APN 3 38951273 missense probably damaging 1.00
IGL02982:Fat4 APN 3 38890843 missense probably damaging 1.00
IGL02993:Fat4 APN 3 38957155 missense probably damaging 1.00
IGL02996:Fat4 APN 3 38958525 missense probably damaging 1.00
IGL03029:Fat4 APN 3 38982591 missense possibly damaging 0.46
IGL03124:Fat4 APN 3 38981552 missense possibly damaging 0.61
IGL03144:Fat4 APN 3 38956859 missense possibly damaging 0.68
IGL03149:Fat4 APN 3 38991685 missense probably damaging 1.00
IGL03169:Fat4 APN 3 38957398 missense probably benign 0.02
IGL03190:Fat4 APN 3 38981241 missense probably damaging 1.00
IGL03272:Fat4 APN 3 39009703 missense probably benign
IGL03371:Fat4 APN 3 38983187 missense possibly damaging 0.65
IGL03372:Fat4 APN 3 38889134 missense possibly damaging 0.88
IGL03388:Fat4 APN 3 38957227 missense probably damaging 1.00
IGL03394:Fat4 APN 3 38892019 missense probably damaging 0.99
IGL03394:Fat4 APN 3 39009364 missense probably damaging 1.00
IGL03405:Fat4 APN 3 38958450 missense probably benign 0.02
IGL03410:Fat4 APN 3 38891176 missense probably damaging 1.00
Expulsion UTSW 3 38889649 missense probably benign 0.00
heineken UTSW 3 38980380 missense probably damaging 1.00
PIT4696001:Fat4 UTSW 3 38889004 missense probably benign 0.04
PIT4696001:Fat4 UTSW 3 38982357 missense probably damaging 0.98
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0015:Fat4 UTSW 3 38982503 missense probably damaging 1.00
R0078:Fat4 UTSW 3 38888931 missense probably benign 0.35
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0100:Fat4 UTSW 3 38980248 missense probably damaging 1.00
R0201:Fat4 UTSW 3 38891596 missense probably damaging 0.99
R0280:Fat4 UTSW 3 38890816 missense probably benign
R0357:Fat4 UTSW 3 38891227 missense probably damaging 1.00
R0409:Fat4 UTSW 3 38977413 missense probably damaging 1.00
R0498:Fat4 UTSW 3 38980637 missense probably benign 0.00
R0502:Fat4 UTSW 3 39002924 missense probably damaging 0.98
R0506:Fat4 UTSW 3 38888314 missense probably benign 0.00
R0532:Fat4 UTSW 3 38981721 missense probably benign 0.02
R0616:Fat4 UTSW 3 38942870 missense probably damaging 1.00
R0630:Fat4 UTSW 3 39000172 missense probably damaging 1.00
R0678:Fat4 UTSW 3 38889694 missense probably damaging 1.00
R0685:Fat4 UTSW 3 39001178 missense probably benign
R0729:Fat4 UTSW 3 39000295 splice site probably benign
R0748:Fat4 UTSW 3 38887828 missense possibly damaging 0.67
R0811:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0812:Fat4 UTSW 3 38957474 missense probably damaging 1.00
R0830:Fat4 UTSW 3 38999109 missense probably benign 0.26
R0841:Fat4 UTSW 3 38995998 missense probably damaging 0.99
R0884:Fat4 UTSW 3 38982858 missense possibly damaging 0.89
R1056:Fat4 UTSW 3 38891392 missense probably damaging 1.00
R1066:Fat4 UTSW 3 38957227 missense probably damaging 1.00
R1078:Fat4 UTSW 3 38983086 missense probably benign 0.10
R1084:Fat4 UTSW 3 38979825 missense possibly damaging 0.88
R1118:Fat4 UTSW 3 38982942 missense possibly damaging 0.88
R1213:Fat4 UTSW 3 38890371 missense probably benign 0.01
R1418:Fat4 UTSW 3 38890813 missense probably damaging 1.00
R1475:Fat4 UTSW 3 38888323 missense probably damaging 1.00
R1487:Fat4 UTSW 3 38995917 missense possibly damaging 0.77
R1511:Fat4 UTSW 3 38983076 missense probably damaging 0.97
R1534:Fat4 UTSW 3 38890089 missense probably damaging 1.00
R1558:Fat4 UTSW 3 38888986 missense probably damaging 1.00
R1586:Fat4 UTSW 3 38888860 missense probably damaging 1.00
R1592:Fat4 UTSW 3 39007177 missense probably damaging 0.99
R1655:Fat4 UTSW 3 38957318 missense probably damaging 0.97
R1662:Fat4 UTSW 3 38980779 missense probably damaging 1.00
R1710:Fat4 UTSW 3 38951155 missense probably damaging 1.00
R1731:Fat4 UTSW 3 38891310 missense probably damaging 1.00
R1761:Fat4 UTSW 3 38887489 missense possibly damaging 0.61
R1770:Fat4 UTSW 3 39010268 missense probably damaging 1.00
R1828:Fat4 UTSW 3 38983458 missense probably damaging 1.00
R1835:Fat4 UTSW 3 38983571 missense probably benign 0.00
R1846:Fat4 UTSW 3 38982383 missense probably benign 0.00
R1861:Fat4 UTSW 3 39010484 missense probably benign 0.09
R1871:Fat4 UTSW 3 38981072 missense possibly damaging 0.63
R1981:Fat4 UTSW 3 38991664 missense probably damaging 1.00
R1988:Fat4 UTSW 3 38887115 missense probably benign
R1988:Fat4 UTSW 3 38996090 missense probably damaging 1.00
R2056:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2058:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2059:Fat4 UTSW 3 38891170 missense possibly damaging 0.88
R2070:Fat4 UTSW 3 39010655 missense probably benign 0.00
R2078:Fat4 UTSW 3 38889673 missense probably damaging 1.00
R2114:Fat4 UTSW 3 38981484 missense probably benign 0.01
R2135:Fat4 UTSW 3 38980733 missense probably damaging 0.98
R2152:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2153:Fat4 UTSW 3 38983395 missense probably damaging 1.00
R2154:Fat4 UTSW 3 38887539 missense probably damaging 1.00
R2196:Fat4 UTSW 3 38981417 missense probably benign 0.23
R2211:Fat4 UTSW 3 38891527 missense possibly damaging 0.77
R2219:Fat4 UTSW 3 39010215 missense probably damaging 1.00
R2247:Fat4 UTSW 3 38892049 missense probably damaging 1.00
R2263:Fat4 UTSW 3 38888989 missense possibly damaging 0.93
R2264:Fat4 UTSW 3 38890422 missense probably benign 0.25
R2274:Fat4 UTSW 3 38995899 missense possibly damaging 0.47
R2337:Fat4 UTSW 3 38980011 missense probably damaging 1.00
R2343:Fat4 UTSW 3 38957105 missense probably damaging 0.97
R2365:Fat4 UTSW 3 38980419 missense probably benign
R2412:Fat4 UTSW 3 38957072 missense probably benign 0.05
R2883:Fat4 UTSW 3 38980804 missense probably damaging 1.00
R2942:Fat4 UTSW 3 38982336 missense probably damaging 1.00
R2989:Fat4 UTSW 3 39007153 missense probably benign
R3103:Fat4 UTSW 3 38891940 missense probably benign 0.03
R3158:Fat4 UTSW 3 38890791 missense possibly damaging 0.87
R3800:Fat4 UTSW 3 38981274 missense possibly damaging 0.48
R3808:Fat4 UTSW 3 38982438 missense possibly damaging 0.52
R3848:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3850:Fat4 UTSW 3 39007261 missense probably benign 0.10
R3957:Fat4 UTSW 3 38982346 missense probably benign
R4065:Fat4 UTSW 3 39009197 missense probably benign 0.13
R4078:Fat4 UTSW 3 38980020 missense probably damaging 1.00
R4096:Fat4 UTSW 3 38887875 missense possibly damaging 0.46
R4161:Fat4 UTSW 3 38942809 missense possibly damaging 0.95
R4273:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R4285:Fat4 UTSW 3 38889171 missense probably benign 0.00
R4288:Fat4 UTSW 3 38891763 missense probably damaging 1.00
R4407:Fat4 UTSW 3 38958540 missense probably benign 0.05
R4528:Fat4 UTSW 3 38891294 missense probably benign 0.01
R4547:Fat4 UTSW 3 38951283 missense probably damaging 1.00
R4681:Fat4 UTSW 3 38887342 missense probably damaging 1.00
R4826:Fat4 UTSW 3 38982957 missense probably damaging 1.00
R4855:Fat4 UTSW 3 38888317 missense probably benign
R4871:Fat4 UTSW 3 38891605 missense probably damaging 1.00
R4897:Fat4 UTSW 3 38980632 missense probably damaging 1.00
R4928:Fat4 UTSW 3 39010465 missense probably damaging 1.00
R4932:Fat4 UTSW 3 39007203 missense probably benign 0.00
R4941:Fat4 UTSW 3 38957452 missense probably damaging 1.00
R4943:Fat4 UTSW 3 38980173 missense probably benign 0.19
R4959:Fat4 UTSW 3 38983046 missense probably benign 0.00
R4973:Fat4 UTSW 3 38983046 missense probably benign 0.00
R5098:Fat4 UTSW 3 38888289 missense probably benign 0.34
R5163:Fat4 UTSW 3 38980797 missense probably damaging 1.00
R5213:Fat4 UTSW 3 38980191 missense possibly damaging 0.56
R5328:Fat4 UTSW 3 38956868 missense probably damaging 1.00
R5337:Fat4 UTSW 3 38891627 missense probably damaging 1.00
R5337:Fat4 UTSW 3 39010378 missense probably benign 0.44
R5363:Fat4 UTSW 3 38888005 missense probably damaging 1.00
R5380:Fat4 UTSW 3 38888864 missense probably damaging 1.00
R5384:Fat4 UTSW 3 38995946 missense possibly damaging 0.87
R5436:Fat4 UTSW 3 38891346 missense probably benign 0.00
R5443:Fat4 UTSW 3 39010370 missense probably damaging 1.00
R5501:Fat4 UTSW 3 38887215 missense probably benign 0.09
R5571:Fat4 UTSW 3 39010274 missense probably damaging 1.00
R5625:Fat4 UTSW 3 38888934 missense possibly damaging 0.78
R5652:Fat4 UTSW 3 39002968 missense probably damaging 0.99
R5725:Fat4 UTSW 3 38889625 missense probably damaging 1.00
R5735:Fat4 UTSW 3 38949576 missense probably damaging 1.00
R5739:Fat4 UTSW 3 38983134 missense probably benign 0.01
R5766:Fat4 UTSW 3 38889468 missense probably damaging 1.00
R5780:Fat4 UTSW 3 38980955 missense probably damaging 0.96
R5811:Fat4 UTSW 3 38891787 missense probably damaging 1.00
R5829:Fat4 UTSW 3 39007305 missense probably damaging 1.00
R5879:Fat4 UTSW 3 38887336 missense probably benign
R5933:Fat4 UTSW 3 38951375 critical splice donor site probably null
R5938:Fat4 UTSW 3 38951239 missense probably damaging 1.00
R5940:Fat4 UTSW 3 38889649 missense probably benign 0.00
R5945:Fat4 UTSW 3 38983206 missense probably benign 0.19
R5963:Fat4 UTSW 3 39010547 missense probably damaging 1.00
R6077:Fat4 UTSW 3 39002802 missense probably damaging 1.00
R6158:Fat4 UTSW 3 38983262 missense possibly damaging 0.95
R6246:Fat4 UTSW 3 38891721 missense probably damaging 1.00
R6253:Fat4 UTSW 3 38951356 missense probably damaging 0.99
R6259:Fat4 UTSW 3 39007246 missense probably benign 0.18
R6295:Fat4 UTSW 3 39007080 splice site probably null
R6387:Fat4 UTSW 3 38983785 missense probably damaging 1.00
R6390:Fat4 UTSW 3 38980380 missense probably damaging 1.00
R6456:Fat4 UTSW 3 38983979 missense possibly damaging 0.90
R6493:Fat4 UTSW 3 38890887 missense probably damaging 1.00
R6500:Fat4 UTSW 3 38981269 nonsense probably null
R6503:Fat4 UTSW 3 38982257 missense probably benign 0.00
R6519:Fat4 UTSW 3 39002871 missense probably benign
R6566:Fat4 UTSW 3 38957126 missense possibly damaging 0.78
R6576:Fat4 UTSW 3 38979690 missense probably benign
R6590:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6658:Fat4 UTSW 3 38942928 missense probably benign 0.01
R6662:Fat4 UTSW 3 38956821 missense possibly damaging 0.95
R6690:Fat4 UTSW 3 38983539 missense probably damaging 1.00
R6807:Fat4 UTSW 3 38982440 missense probably benign 0.18
R6823:Fat4 UTSW 3 38983939 missense probably benign 0.05
R6824:Fat4 UTSW 3 38957525 missense probably benign 0.00
R6830:Fat4 UTSW 3 38981817 missense probably benign 0.00
R6925:Fat4 UTSW 3 38996204 critical splice donor site probably null
R6948:Fat4 UTSW 3 39009446 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38981775 missense probably damaging 1.00
R6970:Fat4 UTSW 3 38995971 missense probably damaging 1.00
R7017:Fat4 UTSW 3 38891543 missense probably benign
R7030:Fat4 UTSW 3 38981958 missense probably damaging 1.00
R7044:Fat4 UTSW 3 39010810 missense probably benign
R7044:Fat4 UTSW 3 39010811 missense probably benign 0.02
R7045:Fat4 UTSW 3 38888601 missense probably benign 0.01
R7094:Fat4 UTSW 3 38889874 missense probably damaging 1.00
R7111:Fat4 UTSW 3 39010533 missense probably damaging 1.00
R7130:Fat4 UTSW 3 38980787 missense probably damaging 0.99
R7168:Fat4 UTSW 3 38980659 missense probably damaging 1.00
R7192:Fat4 UTSW 3 38980464 missense probably benign 0.04
R7194:Fat4 UTSW 3 38888884 missense probably damaging 1.00
R7194:Fat4 UTSW 3 38983895 missense probably damaging 1.00
R7199:Fat4 UTSW 3 38977362 missense probably damaging 0.98
R7213:Fat4 UTSW 3 38999087 missense possibly damaging 0.63
R7216:Fat4 UTSW 3 38891043 missense probably damaging 1.00
R7225:Fat4 UTSW 3 38980176 missense possibly damaging 0.50
R7238:Fat4 UTSW 3 38890413 missense probably benign 0.31
R7239:Fat4 UTSW 3 38983840 missense possibly damaging 0.85
R7283:Fat4 UTSW 3 38889693 missense probably damaging 1.00
R7296:Fat4 UTSW 3 38889145 nonsense probably null
R7372:Fat4 UTSW 3 38890209 missense probably damaging 1.00
R7400:Fat4 UTSW 3 38887924 missense probably damaging 1.00
R7419:Fat4 UTSW 3 39000236 missense probably damaging 1.00
R7430:Fat4 UTSW 3 38887450 missense probably damaging 0.97
R7430:Fat4 UTSW 3 39009644 missense probably damaging 1.00
R7431:Fat4 UTSW 3 39009157 missense possibly damaging 0.80
R7486:Fat4 UTSW 3 38957427 nonsense probably null
R7501:Fat4 UTSW 3 38958448 nonsense probably null
R7533:Fat4 UTSW 3 39007257 missense probably benign 0.43
R7542:Fat4 UTSW 3 38981355 missense possibly damaging 0.56
R7542:Fat4 UTSW 3 38981621 missense possibly damaging 0.64
R7548:Fat4 UTSW 3 38981114 missense probably benign 0.13
R7567:Fat4 UTSW 3 38889336 missense probably damaging 1.00
R7644:Fat4 UTSW 3 39010241 missense possibly damaging 0.64
R7660:Fat4 UTSW 3 38981160 missense probably benign
R7665:Fat4 UTSW 3 38889178 missense probably benign 0.00
R7676:Fat4 UTSW 3 38891697 missense probably damaging 0.98
R7832:Fat4 UTSW 3 39001204 missense probably benign 0.00
R7848:Fat4 UTSW 3 38887851 missense probably benign
R7883:Fat4 UTSW 3 38981819 missense probably damaging 1.00
R7892:Fat4 UTSW 3 38949439 critical splice acceptor site probably null
R7904:Fat4 UTSW 3 38887541 missense probably damaging 1.00
R7952:Fat4 UTSW 3 38891721 missense probably damaging 0.98
R8015:Fat4 UTSW 3 38981916 missense possibly damaging 0.79
R8040:Fat4 UTSW 3 38981666 missense probably damaging 1.00
R8142:Fat4 UTSW 3 38891203 missense probably damaging 1.00
R8151:Fat4 UTSW 3 38892054 missense probably damaging 0.99
R8163:Fat4 UTSW 3 38979732 missense possibly damaging 0.88
R8317:Fat4 UTSW 3 38958510 missense possibly damaging 0.80
X0017:Fat4 UTSW 3 39009106 missense probably benign 0.00
X0019:Fat4 UTSW 3 38981040 missense probably damaging 1.00
X0020:Fat4 UTSW 3 39000151 missense probably damaging 1.00
X0024:Fat4 UTSW 3 38942902 missense probably benign 0.43
X0064:Fat4 UTSW 3 38970752 missense probably damaging 1.00
Z1088:Fat4 UTSW 3 38887050 missense possibly damaging 0.88
Z1088:Fat4 UTSW 3 38958492 missense probably benign 0.00
Z1176:Fat4 UTSW 3 38983359 missense probably benign 0.00
Z1176:Fat4 UTSW 3 38983815 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38888584 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38890347 missense probably damaging 1.00
Z1177:Fat4 UTSW 3 38981838 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGAACTTGGCCGCAAAC -3'
(R):5'- TGTCCAGAATGACCTGACGC -3'

Sequencing Primer
(F):5'- TGCCAGCTCCTGAGAGTCTG -3'
(R):5'- ATGACCTGACGCCCGCTAC -3'
Posted On2016-09-01