Incidental Mutation 'R5422:Epha5'
ID426626
Institutional Source Beutler Lab
Gene Symbol Epha5
Ensembl Gene ENSMUSG00000029245
Gene NameEph receptor A5
SynonymsRek7, Ehk1, Hek7, Cek7, bsk, Els1
MMRRC Submission 042846-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5422 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location84054761-84417382 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 84331490 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 218 (D218E)
Ref Sequence ENSEMBL: ENSMUSP00000109033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053733] [ENSMUST00000113398] [ENSMUST00000113399] [ENSMUST00000113401] [ENSMUST00000113403] [ENSMUST00000113406]
Predicted Effect possibly damaging
Transcript: ENSMUST00000053733
AA Change: D218E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000060646
Gene: ENSMUSG00000029245
AA Change: D218E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 413 511 2.1e-22 PFAM
TyrKc 514 771 9.33e-138 SMART
SAM 801 868 6.65e-23 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000113398
AA Change: D218E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109025
Gene: ENSMUSG00000029245
AA Change: D218E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 359 439 1.92e-12 SMART
Pfam:EphA2_TM 465 563 8.4e-23 PFAM
TyrKc 566 823 9.33e-138 SMART
Pfam:SAM_1 854 894 7.2e-11 PFAM
Pfam:SAM_2 856 894 1.6e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113399
AA Change: D218E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109026
Gene: ENSMUSG00000029245
AA Change: D218E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 3.4e-22 PFAM
TyrKc 678 935 9.33e-138 SMART
Pfam:SAM_1 966 1006 2.9e-10 PFAM
Pfam:SAM_2 968 1006 5.9e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113401
AA Change: D218E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109028
Gene: ENSMUSG00000029245
AA Change: D218E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 307 387 1.92e-12 SMART
Pfam:EphA2_TM 411 488 3.1e-30 PFAM
TyrKc 491 748 9.33e-138 SMART
Pfam:SAM_1 779 819 1.7e-10 PFAM
Pfam:SAM_2 781 819 3.5e-9 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113403
AA Change: D218E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109030
Gene: ENSMUSG00000029245
AA Change: D218E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 577 675 1.2e-25 PFAM
TyrKc 678 935 9.33e-138 SMART
SAM 965 1032 6.65e-23 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000113406
AA Change: D218E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109033
Gene: ENSMUSG00000029245
AA Change: D218E

DomainStartEndE-ValueType
low complexity region 7 20 N/A INTRINSIC
low complexity region 42 57 N/A INTRINSIC
EPH_lbd 62 235 7e-122 SMART
FN3 360 450 1.53e-6 SMART
FN3 471 551 1.92e-12 SMART
Pfam:EphA2_TM 575 652 1.9e-30 PFAM
TyrKc 655 912 9.33e-138 SMART
SAM 942 1009 6.65e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155469
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous mutant mice are overtly normal but show abnormal retinal axon mapping. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,698,974 S1219G probably benign Het
Adgrg5 T A 8: 94,933,952 I73N probably damaging Het
Agmat C A 4: 141,755,833 H193N probably damaging Het
Ambn T C 5: 88,464,511 probably null Het
Atp8b5 T A 4: 43,366,644 C803S probably benign Het
BC005561 T C 5: 104,519,646 I678T probably damaging Het
Btaf1 A T 19: 36,951,107 R109S probably benign Het
Btnl6 C T 17: 34,514,107 G261R possibly damaging Het
Cd163l1 A T 7: 140,224,155 H422L probably benign Het
Clk3 A G 9: 57,765,438 V27A probably benign Het
Clu A G 14: 65,975,602 S146G probably damaging Het
Cyp2w1 T C 5: 139,352,773 F43L probably benign Het
Elf3 C T 1: 135,255,040 E316K probably damaging Het
Ereg T C 5: 91,074,807 probably null Het
Ewsr1 A G 11: 5,080,668 probably benign Het
Fat4 A G 3: 38,887,245 I96V possibly damaging Het
Fgl2 T G 5: 21,375,810 N383K probably damaging Het
Fkbp11 A T 15: 98,728,108 probably null Het
Fn3k C A 11: 121,450,122 P201Q probably damaging Het
Fsip2 A G 2: 82,982,228 I2964V probably benign Het
Gbx1 C T 5: 24,504,669 V393I possibly damaging Het
Gch1 C T 14: 47,157,449 A187T probably damaging Het
Ghdc C A 11: 100,769,194 K242N probably benign Het
Ghrhr A G 6: 55,388,203 H394R probably benign Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,465,228 S236R probably benign Het
Kcnj5 A G 9: 32,317,705 Y66H probably benign Het
Kif15 T A 9: 122,984,889 probably null Het
Magi3 C T 3: 104,051,368 C467Y probably damaging Het
Map7 G T 10: 20,266,766 V303F probably damaging Het
Mapk11 A G 15: 89,146,285 L135P probably damaging Het
Mapkapk5 T A 5: 121,531,722 probably null Het
Myh7b A C 2: 155,631,034 Q1405P probably damaging Het
Nalcn A T 14: 123,515,365 I328N probably damaging Het
Nprl2 C A 9: 107,543,597 R144S probably benign Het
Ogfr A T 2: 180,595,275 D551V probably benign Het
Ogfr G T 2: 180,595,274 D551Y possibly damaging Het
Olfr250 A T 9: 38,367,974 T143S probably benign Het
Olfr524 A T 7: 140,202,392 V126E probably damaging Het
Parp14 T C 16: 35,866,175 K101E probably benign Het
Pcdhb16 A T 18: 37,479,867 T627S probably damaging Het
Pdzrn4 G A 15: 92,677,621 G303S probably benign Het
Plcl1 A T 1: 55,697,384 Y628F probably benign Het
Ptpn9 T A 9: 57,033,157 W194R probably damaging Het
Ranbp9 A T 13: 43,419,626 M474K probably benign Het
Rasgef1a T A 6: 118,088,134 F370Y probably damaging Het
Rassf5 C A 1: 131,181,174 R218L possibly damaging Het
Serpine2 C A 1: 79,816,875 V114L probably benign Het
Serpine2 T C 1: 79,821,489 Y16C probably benign Het
Sgms1 G T 19: 32,159,832 N111K probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tbc1d17 A T 7: 44,848,868 M1K probably null Het
Tcf12 A T 9: 71,869,038 H403Q probably damaging Het
Thsd7b T C 1: 129,921,334 S928P probably benign Het
Tjp1 A T 7: 65,302,967 F1540I probably damaging Het
Tph2 T A 10: 115,079,764 D457V possibly damaging Het
Usp9y T C Y: 1,314,676 I2112V probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp335 T C 2: 164,907,730 K249R probably damaging Het
Zfp54 C A 17: 21,434,526 S427R probably benign Het
Zfp607b A G 7: 27,702,388 T90A probably benign Het
Other mutations in Epha5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00808:Epha5 APN 5 84106700 missense probably damaging 1.00
IGL01084:Epha5 APN 5 84071087 nonsense probably null
IGL01462:Epha5 APN 5 84071233 missense probably damaging 1.00
IGL01516:Epha5 APN 5 84386276 missense probably damaging 1.00
IGL01998:Epha5 APN 5 84084734 missense probably damaging 1.00
IGL02744:Epha5 APN 5 84107989 missense probably benign 0.22
IGL03076:Epha5 APN 5 84331690 missense probably damaging 1.00
IGL03123:Epha5 APN 5 84331226 critical splice donor site probably null
IGL03381:Epha5 APN 5 84331332 missense probably damaging 0.98
BB001:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
BB011:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
PIT4544001:Epha5 UTSW 5 84331612 missense possibly damaging 0.71
R0004:Epha5 UTSW 5 84331842 missense probably damaging 1.00
R0490:Epha5 UTSW 5 84107974 splice site probably benign
R0545:Epha5 UTSW 5 84067358 critical splice donor site probably null
R0835:Epha5 UTSW 5 84386242 missense probably damaging 1.00
R1074:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1074:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1075:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1102:Epha5 UTSW 5 84233575 splice site probably benign
R1184:Epha5 UTSW 5 84071275 splice site probably null
R1255:Epha5 UTSW 5 84150395 missense probably damaging 0.99
R1255:Epha5 UTSW 5 84150396 missense probably damaging 0.99
R1327:Epha5 UTSW 5 84106785 missense probably damaging 1.00
R1437:Epha5 UTSW 5 84233696 missense probably damaging 1.00
R1804:Epha5 UTSW 5 84331815 missense probably benign 0.21
R1967:Epha5 UTSW 5 84416429 missense probably benign 0.23
R2187:Epha5 UTSW 5 84086364 missense probably damaging 1.00
R2282:Epha5 UTSW 5 84150410 missense probably damaging 1.00
R2899:Epha5 UTSW 5 84233808 missense probably damaging 0.99
R3746:Epha5 UTSW 5 84059104 missense probably damaging 1.00
R4454:Epha5 UTSW 5 84156444 missense probably damaging 1.00
R4771:Epha5 UTSW 5 84150419 missense probably damaging 0.99
R4809:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4810:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4825:Epha5 UTSW 5 84233840 missense probably damaging 0.97
R4833:Epha5 UTSW 5 84105891 missense possibly damaging 0.88
R4961:Epha5 UTSW 5 84233643 missense probably damaging 1.00
R4976:Epha5 UTSW 5 84084824 missense probably damaging 1.00
R4981:Epha5 UTSW 5 84150483 missense probably damaging 1.00
R5149:Epha5 UTSW 5 84150358 missense probably damaging 1.00
R5575:Epha5 UTSW 5 84416502 missense probably damaging 0.97
R5664:Epha5 UTSW 5 84331866 missense probably damaging 1.00
R5801:Epha5 UTSW 5 84331226 critical splice donor site probably null
R5821:Epha5 UTSW 5 84084728 missense probably damaging 1.00
R5924:Epha5 UTSW 5 84233674 nonsense probably null
R5951:Epha5 UTSW 5 84331192 intron probably benign
R5956:Epha5 UTSW 5 84150369 missense probably damaging 0.99
R6127:Epha5 UTSW 5 84071094 missense probably damaging 1.00
R6189:Epha5 UTSW 5 84237540 missense probably damaging 1.00
R6240:Epha5 UTSW 5 84117579 missense probably benign 0.27
R6343:Epha5 UTSW 5 84106747 missense probably damaging 1.00
R6463:Epha5 UTSW 5 84106710 missense probably damaging 1.00
R6517:Epha5 UTSW 5 84156501 missense possibly damaging 0.63
R6622:Epha5 UTSW 5 84237528 missense possibly damaging 0.79
R6667:Epha5 UTSW 5 84071191 missense probably damaging 1.00
R6741:Epha5 UTSW 5 84106698 missense possibly damaging 0.69
R6757:Epha5 UTSW 5 84105878 missense probably damaging 1.00
R6762:Epha5 UTSW 5 84331726 missense probably damaging 1.00
R6819:Epha5 UTSW 5 84106790 missense probably damaging 1.00
R7019:Epha5 UTSW 5 84416462 missense possibly damaging 0.68
R7031:Epha5 UTSW 5 84142300 missense probably benign 0.12
R7213:Epha5 UTSW 5 84233923 splice site probably null
R7728:Epha5 UTSW 5 84067408 missense possibly damaging 0.95
R7924:Epha5 UTSW 5 84084846 missense possibly damaging 0.71
R7953:Epha5 UTSW 5 84233654 missense probably benign 0.19
R8043:Epha5 UTSW 5 84233654 missense probably benign 0.19
Z1088:Epha5 UTSW 5 84237522 missense probably benign 0.01
Z1176:Epha5 UTSW 5 84071120 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GGGAGGATCATCTGTCACAG -3'
(R):5'- TTAAGGGACTGCAACAGCC -3'

Sequencing Primer
(F):5'- CATCTGTCACAGAATGGTTGACGC -3'
(R):5'- AACAGCCTTCCTGGAGGACTG -3'
Posted On2016-09-01