Incidental Mutation 'R5422:Ambn'
ID 426627
Institutional Source Beutler Lab
Gene Symbol Ambn
Ensembl Gene ENSMUSG00000029288
Gene Name ameloblastin
Synonyms
MMRRC Submission 042846-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.271) question?
Stock # R5422 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 88455991-88468531 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 88464511 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031226] [ENSMUST00000198265]
AlphaFold O55189
Predicted Effect probably null
Transcript: ENSMUST00000031226
SMART Domains Protein: ENSMUSP00000031226
Gene: ENSMUSG00000029288

DomainStartEndE-ValueType
Amelin 11 407 7.19e-250 SMART
Predicted Effect probably null
Transcript: ENSMUST00000198265
SMART Domains Protein: ENSMUSP00000142944
Gene: ENSMUSG00000029288

DomainStartEndE-ValueType
Amelin 11 422 8.22e-268 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an extracellular matrix glycoprotein that is involved in the formation of dental enamel. Mice lacking the encoded protein fail to undergo normal ameloblast differentiation and develop enamel. Mice overproducing the product of this gene develop thinner and more porous enamel, with disrupted rod patterns and abnormal crystallites. Alternate splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice lack enamel and display abnormal ameloblast and tooth morphology and an increased incidence of dental epithelium derived tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,698,974 S1219G probably benign Het
Adgrg5 T A 8: 94,933,952 I73N probably damaging Het
Agmat C A 4: 141,755,833 H193N probably damaging Het
Atp8b5 T A 4: 43,366,644 C803S probably benign Het
BC005561 T C 5: 104,519,646 I678T probably damaging Het
Btaf1 A T 19: 36,951,107 R109S probably benign Het
Btnl6 C T 17: 34,514,107 G261R possibly damaging Het
Cd163l1 A T 7: 140,224,155 H422L probably benign Het
Clk3 A G 9: 57,765,438 V27A probably benign Het
Clu A G 14: 65,975,602 S146G probably damaging Het
Cyp2w1 T C 5: 139,352,773 F43L probably benign Het
Elf3 C T 1: 135,255,040 E316K probably damaging Het
Epha5 A T 5: 84,331,490 D218E probably damaging Het
Ereg T C 5: 91,074,807 probably null Het
Ewsr1 A G 11: 5,080,668 probably benign Het
Fat4 A G 3: 38,887,245 I96V possibly damaging Het
Fgl2 T G 5: 21,375,810 N383K probably damaging Het
Fkbp11 A T 15: 98,728,108 probably null Het
Fn3k C A 11: 121,450,122 P201Q probably damaging Het
Fsip2 A G 2: 82,982,228 I2964V probably benign Het
Gbx1 C T 5: 24,504,669 V393I possibly damaging Het
Gch1 C T 14: 47,157,449 A187T probably damaging Het
Ghdc C A 11: 100,769,194 K242N probably benign Het
Ghrhr A G 6: 55,388,203 H394R probably benign Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,465,228 S236R probably benign Het
Kcnj5 A G 9: 32,317,705 Y66H probably benign Het
Kif15 T A 9: 122,984,889 probably null Het
Magi3 C T 3: 104,051,368 C467Y probably damaging Het
Map7 G T 10: 20,266,766 V303F probably damaging Het
Mapk11 A G 15: 89,146,285 L135P probably damaging Het
Mapkapk5 T A 5: 121,531,722 probably null Het
Myh7b A C 2: 155,631,034 Q1405P probably damaging Het
Nalcn A T 14: 123,515,365 I328N probably damaging Het
Nprl2 C A 9: 107,543,597 R144S probably benign Het
Ogfr G T 2: 180,595,274 D551Y possibly damaging Het
Ogfr A T 2: 180,595,275 D551V probably benign Het
Olfr250 A T 9: 38,367,974 T143S probably benign Het
Olfr524 A T 7: 140,202,392 V126E probably damaging Het
Parp14 T C 16: 35,866,175 K101E probably benign Het
Pcdhb16 A T 18: 37,479,867 T627S probably damaging Het
Pdzrn4 G A 15: 92,677,621 G303S probably benign Het
Plcl1 A T 1: 55,697,384 Y628F probably benign Het
Ptpn9 T A 9: 57,033,157 W194R probably damaging Het
Ranbp9 A T 13: 43,419,626 M474K probably benign Het
Rasgef1a T A 6: 118,088,134 F370Y probably damaging Het
Rassf5 C A 1: 131,181,174 R218L possibly damaging Het
Serpine2 C A 1: 79,816,875 V114L probably benign Het
Serpine2 T C 1: 79,821,489 Y16C probably benign Het
Sgms1 G T 19: 32,159,832 N111K probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tbc1d17 A T 7: 44,848,868 M1K probably null Het
Tcf12 A T 9: 71,869,038 H403Q probably damaging Het
Thsd7b T C 1: 129,921,334 S928P probably benign Het
Tjp1 A T 7: 65,302,967 F1540I probably damaging Het
Tph2 T A 10: 115,079,764 D457V possibly damaging Het
Usp9y T C Y: 1,314,676 I2112V probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp335 T C 2: 164,907,730 K249R probably damaging Het
Zfp54 C A 17: 21,434,526 S427R probably benign Het
Zfp607b A G 7: 27,702,388 T90A probably benign Het
Other mutations in Ambn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01017:Ambn APN 5 88459359 missense probably damaging 0.99
IGL01139:Ambn APN 5 88464517 splice site probably benign
IGL01318:Ambn APN 5 88460695 splice site probably benign
IGL02139:Ambn APN 5 88465290 missense probably benign
IGL02261:Ambn APN 5 88456948 missense probably damaging 1.00
IGL02743:Ambn APN 5 88464484 missense probably damaging 0.99
IGL03329:Ambn APN 5 88461668 missense probably benign 0.34
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0242:Ambn UTSW 5 88467972 missense possibly damaging 0.85
R0563:Ambn UTSW 5 88463450 missense probably benign 0.28
R1649:Ambn UTSW 5 88464481 missense probably benign 0.16
R2118:Ambn UTSW 5 88460758 splice site probably benign
R2121:Ambn UTSW 5 88460758 splice site probably benign
R2124:Ambn UTSW 5 88460758 splice site probably benign
R2495:Ambn UTSW 5 88467804 missense probably benign 0.05
R2877:Ambn UTSW 5 88460700 splice site probably benign
R3779:Ambn UTSW 5 88465342 splice site probably benign
R4760:Ambn UTSW 5 88467707 missense probably damaging 1.00
R5755:Ambn UTSW 5 88464491 splice site probably null
R5883:Ambn UTSW 5 88467829 nonsense probably null
R5970:Ambn UTSW 5 88467951 missense possibly damaging 0.88
R6846:Ambn UTSW 5 88461715 missense possibly damaging 0.65
R7166:Ambn UTSW 5 88467528 missense possibly damaging 0.94
R7500:Ambn UTSW 5 88461634 missense possibly damaging 0.95
R7809:Ambn UTSW 5 88467824 missense probably benign 0.00
R8306:Ambn UTSW 5 88459422 missense possibly damaging 0.95
R8898:Ambn UTSW 5 88465192 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTGGAGCCATGTCAATATAAGAC -3'
(R):5'- GACTTTTAAGAGTTCCAGGAACAC -3'

Sequencing Primer
(F):5'- CTAGAGGTGTACTCAGTTTG -3'
(R):5'- GATTAGTGTGAAAACTTAGCAC -3'
Posted On 2016-09-01