Incidental Mutation 'R5422:Scart1'
ID 426640
Institutional Source Beutler Lab
Gene Symbol Scart1
Ensembl Gene ENSMUSG00000025461
Gene Name scavenger receptor family member expressed on T cells 1
Synonyms E430002D04Rik, Cd163l1
MMRRC Submission 042846-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5422 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 139798180-139811058 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 139804068 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 422 (H422L)
Ref Sequence ENSEMBL: ENSMUSP00000147699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084460] [ENSMUST00000209398] [ENSMUST00000209637]
AlphaFold A0A1B0GSB0
Predicted Effect probably benign
Transcript: ENSMUST00000084460
AA Change: H422L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000081497
Gene: ENSMUSG00000025461
AA Change: H422L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SR 32 132 1.45e-30 SMART
SR 139 230 4.28e-6 SMART
SR 235 333 2.76e-36 SMART
SR 335 435 1.32e-33 SMART
SR 441 541 5.01e-25 SMART
SR 546 646 7.16e-53 SMART
SR 651 752 3.44e-14 SMART
SR 780 880 8.96e-45 SMART
low complexity region 882 898 N/A INTRINSIC
transmembrane domain 907 929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209376
Predicted Effect probably benign
Transcript: ENSMUST00000209398
AA Change: H422L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000209637
AA Change: H422L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211540
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 114,425,606 (GRCm39) S1219G probably benign Het
Adgrg5 T A 8: 95,660,580 (GRCm39) I73N probably damaging Het
Agmat C A 4: 141,483,144 (GRCm39) H193N probably damaging Het
Ambn T C 5: 88,612,370 (GRCm39) probably null Het
Atp8b5 T A 4: 43,366,644 (GRCm39) C803S probably benign Het
Btaf1 A T 19: 36,928,507 (GRCm39) R109S probably benign Het
Btnl6 C T 17: 34,733,081 (GRCm39) G261R possibly damaging Het
Clk3 A G 9: 57,672,721 (GRCm39) V27A probably benign Het
Clu A G 14: 66,213,051 (GRCm39) S146G probably damaging Het
Cyp2w1 T C 5: 139,338,528 (GRCm39) F43L probably benign Het
Elf3 C T 1: 135,182,778 (GRCm39) E316K probably damaging Het
Epha5 A T 5: 84,479,349 (GRCm39) D218E probably damaging Het
Ereg T C 5: 91,222,666 (GRCm39) probably null Het
Ewsr1 A G 11: 5,030,668 (GRCm39) probably benign Het
Fat4 A G 3: 38,941,394 (GRCm39) I96V possibly damaging Het
Fgl2 T G 5: 21,580,808 (GRCm39) N383K probably damaging Het
Fkbp11 A T 15: 98,625,989 (GRCm39) probably null Het
Fn3k C A 11: 121,340,948 (GRCm39) P201Q probably damaging Het
Fsip2 A G 2: 82,812,572 (GRCm39) I2964V probably benign Het
Gbx1 C T 5: 24,709,667 (GRCm39) V393I possibly damaging Het
Gch1 C T 14: 47,394,906 (GRCm39) A187T probably damaging Het
Ghdc C A 11: 100,660,020 (GRCm39) K242N probably benign Het
Ghrhr A G 6: 55,365,188 (GRCm39) H394R probably benign Het
Gje1 G A 10: 14,592,428 (GRCm39) S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,442,208 (GRCm39) S236R probably benign Het
Kcnj5 A G 9: 32,229,001 (GRCm39) Y66H probably benign Het
Kif15 T A 9: 122,813,954 (GRCm39) probably null Het
Magi3 C T 3: 103,958,684 (GRCm39) C467Y probably damaging Het
Map7 G T 10: 20,142,512 (GRCm39) V303F probably damaging Het
Mapk11 A G 15: 89,030,488 (GRCm39) L135P probably damaging Het
Mapkapk5 T A 5: 121,669,785 (GRCm39) probably null Het
Myh7b A C 2: 155,472,954 (GRCm39) Q1405P probably damaging Het
Nalcn A T 14: 123,752,777 (GRCm39) I328N probably damaging Het
Nprl2 C A 9: 107,420,796 (GRCm39) R144S probably benign Het
Ogfr G T 2: 180,237,067 (GRCm39) D551Y possibly damaging Het
Ogfr A T 2: 180,237,068 (GRCm39) D551V probably benign Het
Or6b13 A T 7: 139,782,305 (GRCm39) V126E probably damaging Het
Or8c10 A T 9: 38,279,270 (GRCm39) T143S probably benign Het
Parp14 T C 16: 35,686,545 (GRCm39) K101E probably benign Het
Pcdhb16 A T 18: 37,612,920 (GRCm39) T627S probably damaging Het
Pdzrn4 G A 15: 92,575,502 (GRCm39) G303S probably benign Het
Plcl1 A T 1: 55,736,543 (GRCm39) Y628F probably benign Het
Ptpn9 T A 9: 56,940,441 (GRCm39) W194R probably damaging Het
Ranbp9 A T 13: 43,573,102 (GRCm39) M474K probably benign Het
Rasgef1a T A 6: 118,065,095 (GRCm39) F370Y probably damaging Het
Rassf5 C A 1: 131,108,911 (GRCm39) R218L possibly damaging Het
Serpine2 C A 1: 79,794,592 (GRCm39) V114L probably benign Het
Serpine2 T C 1: 79,799,206 (GRCm39) Y16C probably benign Het
Sgms1 G T 19: 32,137,232 (GRCm39) N111K probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Tbc1d17 A T 7: 44,498,292 (GRCm39) M1K probably null Het
Tcf12 A T 9: 71,776,320 (GRCm39) H403Q probably damaging Het
Thoc2l T C 5: 104,667,512 (GRCm39) I678T probably damaging Het
Thsd7b T C 1: 129,849,071 (GRCm39) S928P probably benign Het
Tjp1 A T 7: 64,952,715 (GRCm39) F1540I probably damaging Het
Tph2 T A 10: 114,915,669 (GRCm39) D457V possibly damaging Het
Usp9y T C Y: 1,314,676 (GRCm39) I2112V probably benign Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Zfp335 T C 2: 164,749,650 (GRCm39) K249R probably damaging Het
Zfp54 C A 17: 21,654,788 (GRCm39) S427R probably benign Het
Zfp607b A G 7: 27,401,813 (GRCm39) T90A probably benign Het
Other mutations in Scart1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Scart1 APN 7 139,804,552 (GRCm39) critical splice donor site probably null
IGL01921:Scart1 APN 7 139,808,632 (GRCm39) nonsense probably null
IGL02168:Scart1 APN 7 139,803,399 (GRCm39) missense probably benign 0.02
IGL02306:Scart1 APN 7 139,803,269 (GRCm39) missense probably damaging 1.00
IGL02323:Scart1 APN 7 139,808,572 (GRCm39) missense probably benign 0.10
IGL02457:Scart1 APN 7 139,800,308 (GRCm39) missense probably benign 0.07
IGL02543:Scart1 APN 7 139,800,491 (GRCm39) missense probably benign 0.00
IGL02831:Scart1 APN 7 139,808,434 (GRCm39) missense probably benign 0.14
IGL03289:Scart1 APN 7 139,808,973 (GRCm39) critical splice donor site probably null
lop UTSW 7 139,804,376 (GRCm39) missense possibly damaging 0.91
R0357:Scart1 UTSW 7 139,807,808 (GRCm39) missense probably damaging 1.00
R0513:Scart1 UTSW 7 139,804,873 (GRCm39) nonsense probably null
R1023:Scart1 UTSW 7 139,804,376 (GRCm39) missense possibly damaging 0.91
R1519:Scart1 UTSW 7 139,808,069 (GRCm39) missense probably benign 0.07
R1711:Scart1 UTSW 7 139,800,522 (GRCm39) missense probably damaging 1.00
R2327:Scart1 UTSW 7 139,803,890 (GRCm39) missense possibly damaging 0.48
R4957:Scart1 UTSW 7 139,808,435 (GRCm39) missense probably damaging 0.99
R5421:Scart1 UTSW 7 139,803,813 (GRCm39) missense probably damaging 1.00
R5851:Scart1 UTSW 7 139,807,940 (GRCm39) missense possibly damaging 0.93
R5906:Scart1 UTSW 7 139,808,712 (GRCm39) missense probably damaging 1.00
R5930:Scart1 UTSW 7 139,810,359 (GRCm39) missense probably benign 0.32
R6376:Scart1 UTSW 7 139,808,642 (GRCm39) missense probably damaging 1.00
R7380:Scart1 UTSW 7 139,804,790 (GRCm39) missense possibly damaging 0.47
R7389:Scart1 UTSW 7 139,808,704 (GRCm39) missense possibly damaging 0.95
R7466:Scart1 UTSW 7 139,800,619 (GRCm39) critical splice donor site probably null
R7686:Scart1 UTSW 7 139,802,116 (GRCm39) nonsense probably null
R7722:Scart1 UTSW 7 139,802,299 (GRCm39) nonsense probably null
R8535:Scart1 UTSW 7 139,804,634 (GRCm39) missense probably benign 0.06
R8900:Scart1 UTSW 7 139,808,478 (GRCm39) nonsense probably null
R9041:Scart1 UTSW 7 139,808,503 (GRCm39) missense probably damaging 1.00
R9116:Scart1 UTSW 7 139,808,277 (GRCm39) missense probably benign
R9319:Scart1 UTSW 7 139,807,940 (GRCm39) missense possibly damaging 0.93
Z1176:Scart1 UTSW 7 139,804,770 (GRCm39) missense probably benign 0.17
Z1186:Scart1 UTSW 7 139,804,403 (GRCm39) missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CCTAGCAGATGCCATGGTTC -3'
(R):5'- GGGAAATCTCTACACGGCCATC -3'

Sequencing Primer
(F):5'- AGCAGATGCCATGGTTCTCTGTC -3'
(R):5'- CGCAGGATGTCTTGGAGTCC -3'
Posted On 2016-09-01