Incidental Mutation 'R5422:Cd163l1'
ID 426640
Institutional Source Beutler Lab
Gene Symbol Cd163l1
Ensembl Gene ENSMUSG00000025461
Gene Name CD163 molecule-like 1
Synonyms E430002D04Rik, Scart1
MMRRC Submission 042846-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5422 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 140218267-140231145 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 140224155 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 422 (H422L)
Ref Sequence ENSEMBL: ENSMUSP00000147699 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084460] [ENSMUST00000209398] [ENSMUST00000209637]
AlphaFold A0A1B0GSB0
Predicted Effect probably benign
Transcript: ENSMUST00000084460
AA Change: H422L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000081497
Gene: ENSMUSG00000025461
AA Change: H422L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
SR 32 132 1.45e-30 SMART
SR 139 230 4.28e-6 SMART
SR 235 333 2.76e-36 SMART
SR 335 435 1.32e-33 SMART
SR 441 541 5.01e-25 SMART
SR 546 646 7.16e-53 SMART
SR 651 752 3.44e-14 SMART
SR 780 880 8.96e-45 SMART
low complexity region 882 898 N/A INTRINSIC
transmembrane domain 907 929 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209376
Predicted Effect probably benign
Transcript: ENSMUST00000209398
AA Change: H422L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect probably benign
Transcript: ENSMUST00000209637
AA Change: H422L

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210159
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211540
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,698,974 S1219G probably benign Het
Adgrg5 T A 8: 94,933,952 I73N probably damaging Het
Agmat C A 4: 141,755,833 H193N probably damaging Het
Ambn T C 5: 88,464,511 probably null Het
Atp8b5 T A 4: 43,366,644 C803S probably benign Het
BC005561 T C 5: 104,519,646 I678T probably damaging Het
Btaf1 A T 19: 36,951,107 R109S probably benign Het
Btnl6 C T 17: 34,514,107 G261R possibly damaging Het
Clk3 A G 9: 57,765,438 V27A probably benign Het
Clu A G 14: 65,975,602 S146G probably damaging Het
Cyp2w1 T C 5: 139,352,773 F43L probably benign Het
Elf3 C T 1: 135,255,040 E316K probably damaging Het
Epha5 A T 5: 84,331,490 D218E probably damaging Het
Ereg T C 5: 91,074,807 probably null Het
Ewsr1 A G 11: 5,080,668 probably benign Het
Fat4 A G 3: 38,887,245 I96V possibly damaging Het
Fgl2 T G 5: 21,375,810 N383K probably damaging Het
Fkbp11 A T 15: 98,728,108 probably null Het
Fn3k C A 11: 121,450,122 P201Q probably damaging Het
Fsip2 A G 2: 82,982,228 I2964V probably benign Het
Gbx1 C T 5: 24,504,669 V393I possibly damaging Het
Gch1 C T 14: 47,157,449 A187T probably damaging Het
Ghdc C A 11: 100,769,194 K242N probably benign Het
Ghrhr A G 6: 55,388,203 H394R probably benign Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,465,228 S236R probably benign Het
Kcnj5 A G 9: 32,317,705 Y66H probably benign Het
Kif15 T A 9: 122,984,889 probably null Het
Magi3 C T 3: 104,051,368 C467Y probably damaging Het
Map7 G T 10: 20,266,766 V303F probably damaging Het
Mapk11 A G 15: 89,146,285 L135P probably damaging Het
Mapkapk5 T A 5: 121,531,722 probably null Het
Myh7b A C 2: 155,631,034 Q1405P probably damaging Het
Nalcn A T 14: 123,515,365 I328N probably damaging Het
Nprl2 C A 9: 107,543,597 R144S probably benign Het
Ogfr G T 2: 180,595,274 D551Y possibly damaging Het
Ogfr A T 2: 180,595,275 D551V probably benign Het
Olfr250 A T 9: 38,367,974 T143S probably benign Het
Olfr524 A T 7: 140,202,392 V126E probably damaging Het
Parp14 T C 16: 35,866,175 K101E probably benign Het
Pcdhb16 A T 18: 37,479,867 T627S probably damaging Het
Pdzrn4 G A 15: 92,677,621 G303S probably benign Het
Plcl1 A T 1: 55,697,384 Y628F probably benign Het
Ptpn9 T A 9: 57,033,157 W194R probably damaging Het
Ranbp9 A T 13: 43,419,626 M474K probably benign Het
Rasgef1a T A 6: 118,088,134 F370Y probably damaging Het
Rassf5 C A 1: 131,181,174 R218L possibly damaging Het
Serpine2 C A 1: 79,816,875 V114L probably benign Het
Serpine2 T C 1: 79,821,489 Y16C probably benign Het
Sgms1 G T 19: 32,159,832 N111K probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tbc1d17 A T 7: 44,848,868 M1K probably null Het
Tcf12 A T 9: 71,869,038 H403Q probably damaging Het
Thsd7b T C 1: 129,921,334 S928P probably benign Het
Tjp1 A T 7: 65,302,967 F1540I probably damaging Het
Tph2 T A 10: 115,079,764 D457V possibly damaging Het
Usp9y T C Y: 1,314,676 I2112V probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp335 T C 2: 164,907,730 K249R probably damaging Het
Zfp54 C A 17: 21,434,526 S427R probably benign Het
Zfp607b A G 7: 27,702,388 T90A probably benign Het
Other mutations in Cd163l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cd163l1 APN 7 140224639 critical splice donor site probably null
IGL01921:Cd163l1 APN 7 140228719 nonsense probably null
IGL02168:Cd163l1 APN 7 140223486 missense probably benign 0.02
IGL02306:Cd163l1 APN 7 140223356 missense probably damaging 1.00
IGL02323:Cd163l1 APN 7 140228659 missense probably benign 0.10
IGL02457:Cd163l1 APN 7 140220395 missense probably benign 0.07
IGL02543:Cd163l1 APN 7 140220578 missense probably benign 0.00
IGL02831:Cd163l1 APN 7 140228521 missense probably benign 0.14
IGL03289:Cd163l1 APN 7 140229060 critical splice donor site probably null
lop UTSW 7 140224463 missense possibly damaging 0.91
R0357:Cd163l1 UTSW 7 140227895 missense probably damaging 1.00
R0513:Cd163l1 UTSW 7 140224960 nonsense probably null
R1023:Cd163l1 UTSW 7 140224463 missense possibly damaging 0.91
R1519:Cd163l1 UTSW 7 140228156 missense probably benign 0.07
R1711:Cd163l1 UTSW 7 140220609 missense probably damaging 1.00
R2327:Cd163l1 UTSW 7 140223977 missense possibly damaging 0.48
R4957:Cd163l1 UTSW 7 140228522 missense probably damaging 0.99
R5421:Cd163l1 UTSW 7 140223900 missense probably damaging 1.00
R5851:Cd163l1 UTSW 7 140228027 missense possibly damaging 0.93
R5906:Cd163l1 UTSW 7 140228799 missense probably damaging 1.00
R5930:Cd163l1 UTSW 7 140230446 missense probably benign 0.32
R6376:Cd163l1 UTSW 7 140228729 missense probably damaging 1.00
R7380:Cd163l1 UTSW 7 140224877 missense possibly damaging 0.47
R7389:Cd163l1 UTSW 7 140228791 missense possibly damaging 0.95
R7466:Cd163l1 UTSW 7 140220706 critical splice donor site probably null
R7686:Cd163l1 UTSW 7 140222203 nonsense probably null
R7722:Cd163l1 UTSW 7 140222386 nonsense probably null
R8535:Cd163l1 UTSW 7 140224721 missense probably benign 0.06
R8900:Cd163l1 UTSW 7 140228565 nonsense probably null
R9041:Cd163l1 UTSW 7 140228590 missense probably damaging 1.00
R9116:Cd163l1 UTSW 7 140228364 missense probably benign
R9319:Cd163l1 UTSW 7 140228027 missense possibly damaging 0.93
Z1176:Cd163l1 UTSW 7 140224857 missense probably benign 0.17
Z1186:Cd163l1 UTSW 7 140224490 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- CCTAGCAGATGCCATGGTTC -3'
(R):5'- GGGAAATCTCTACACGGCCATC -3'

Sequencing Primer
(F):5'- AGCAGATGCCATGGTTCTCTGTC -3'
(R):5'- CGCAGGATGTCTTGGAGTCC -3'
Posted On 2016-09-01