Incidental Mutation 'R0494:Shprh'
ID 42665
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 038691-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0494 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 11149427-11217595 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11157191 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 307 (V307A)
Ref Sequence ENSEMBL: ENSMUSP00000125457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: V307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054814
AA Change: V307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: V307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159810
AA Change: V307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161858
Meta Mutation Damage Score 0.8240 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (109/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik G A 5: 9,420,723 probably null Het
Aatf T C 11: 84,511,513 I116V probably benign Het
Abhd18 T C 3: 40,916,688 F94S probably damaging Het
Adam28 T A 14: 68,630,792 probably benign Het
Amn1 A T 6: 149,185,136 probably benign Het
Arhgap32 T C 9: 32,258,903 V993A probably damaging Het
Arhgap33 A T 7: 30,524,496 S703T probably damaging Het
Arhgef1 T C 7: 24,919,360 probably benign Het
Atg2a A G 19: 6,253,377 Y1083C probably damaging Het
Atp2a3 T C 11: 72,981,905 F760L probably damaging Het
B9d1 A G 11: 61,512,445 probably benign Het
Batf C T 12: 85,686,862 probably benign Het
BC051019 T A 7: 109,717,975 Y170F probably benign Het
Bphl T C 13: 34,037,771 *37Q probably null Het
Cab39l T C 14: 59,499,559 S43P probably damaging Het
Cad A G 5: 31,077,512 probably benign Het
Cct4 T G 11: 22,996,014 S119A probably benign Het
Cd163 G A 6: 124,311,449 V280M probably damaging Het
Cd86 A G 16: 36,618,637 probably benign Het
Cdh23 G A 10: 60,316,596 probably benign Het
Cdhr5 A G 7: 141,272,518 F145S probably damaging Het
Cdt1 T C 8: 122,572,060 S479P possibly damaging Het
Ces2g T C 8: 104,966,567 V372A probably benign Het
Chrna3 T C 9: 55,022,278 D92G probably damaging Het
Cndp1 A G 18: 84,619,533 S359P probably benign Het
Cops4 A G 5: 100,528,662 Q93R probably damaging Het
Dgka G C 10: 128,721,083 probably benign Het
Dmp1 A T 5: 104,212,208 D250V probably damaging Het
Dnajb2 C T 1: 75,239,634 probably benign Het
Dock9 T C 14: 121,662,584 T113A possibly damaging Het
Egln3 T A 12: 54,203,321 I81F probably benign Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Esco1 A T 18: 10,594,940 N115K probably benign Het
Fat1 A T 8: 44,950,542 N110I probably damaging Het
Fezf1 T A 6: 23,246,055 K370N probably damaging Het
Galnt18 T A 7: 111,554,564 K284N probably damaging Het
Glt8d1 C A 14: 31,011,623 T355K possibly damaging Het
Gm13083 G T 4: 143,616,156 V278F probably benign Het
Gm17455 G A 10: 60,403,235 R93H possibly damaging Het
Gng8 T A 7: 16,895,288 D46E probably benign Het
Gpx4 T C 10: 80,056,177 probably benign Het
Grk2 A T 19: 4,291,319 N189K probably damaging Het
Grm5 T C 7: 88,130,781 V1143A probably benign Het
Hibch A G 1: 52,902,896 E237G possibly damaging Het
Hipk2 C T 6: 38,729,989 A682T probably benign Het
Hmcn1 G T 1: 150,732,792 probably benign Het
Htt A G 5: 34,821,844 D857G possibly damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Igsf8 A G 1: 172,318,698 E421G probably benign Het
Kif26a T A 12: 112,179,471 probably null Het
Klhl26 T C 8: 70,451,601 Y519C probably damaging Het
Lamc1 A C 1: 153,246,936 probably null Het
Mical3 A T 6: 120,959,201 S1455T possibly damaging Het
Mitf G A 6: 97,994,429 G186S probably benign Het
Ms4a15 G A 19: 10,981,358 probably benign Het
Myo5b A G 18: 74,653,967 E481G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nbeal2 C A 9: 110,627,187 V1686L probably damaging Het
Nedd4l T G 18: 65,173,021 S335A possibly damaging Het
Nos1 A T 5: 117,905,474 N605Y probably damaging Het
Nyx C A X: 13,487,269 T454K probably benign Het
Olfr666 A G 7: 104,893,271 L119P probably damaging Het
Olfr972 T A 9: 39,873,402 N42K probably damaging Het
Pcdhb12 T A 18: 37,438,095 F765I probably benign Het
Pex3 C T 10: 13,527,788 G330R probably damaging Het
Pfkfb1 T C X: 150,634,613 Y339H probably damaging Het
Pias1 G A 9: 62,887,311 Q26* probably null Het
Pik3cg C A 12: 32,204,546 V481L possibly damaging Het
Plcg2 C T 8: 117,556,104 T108M probably damaging Het
Pon2 G A 6: 5,267,059 probably benign Het
Ppef2 A T 5: 92,253,093 probably benign Het
Ptpn22 A G 3: 103,860,455 K18E probably damaging Het
Pum2 C T 12: 8,721,736 Q360* probably null Het
Rab10 A C 12: 3,252,723 probably null Het
Ranbp2 T G 10: 58,467,432 S809A possibly damaging Het
Rbms2 A G 10: 128,133,670 V348A probably benign Het
Rnf213 A G 11: 119,426,012 E988G possibly damaging Het
Rnf213 A T 11: 119,443,120 M3052L probably damaging Het
Rpl14 C A 9: 120,574,362 probably benign Het
Rplp0 A G 5: 115,559,872 Y13C possibly damaging Het
Ryr1 A G 7: 29,003,793 probably benign Het
Sac3d1 T C 19: 6,118,294 E98G probably damaging Het
Scn10a T A 9: 119,624,100 D1242V probably damaging Het
Scnn1b T C 7: 121,899,458 Y74H probably damaging Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Sf3b4 C A 3: 96,173,701 D108E probably damaging Het
Slc2a2 A G 3: 28,727,277 D458G probably benign Het
Spata5 G C 3: 37,432,163 D345H possibly damaging Het
Strc T C 2: 121,379,533 D103G probably damaging Het
Synrg T C 11: 84,019,543 I923T probably benign Het
Tango6 G T 8: 106,735,682 probably benign Het
Tas2r106 A G 6: 131,678,576 L104P probably damaging Het
Tat C T 8: 109,991,684 P67L probably damaging Het
Tln2 A C 9: 67,355,197 S593A probably benign Het
Tmem94 A G 11: 115,794,781 probably null Het
Tppp3 G A 8: 105,468,172 A109V probably benign Het
Trank1 T C 9: 111,391,293 F2366S probably benign Het
Trpc5 T A X: 144,481,396 Y155F probably damaging Het
Trpv1 A G 11: 73,260,442 T451A probably benign Het
Ttc9 C A 12: 81,631,649 A82E probably damaging Het
Ttll11 T A 2: 35,944,874 N180I probably damaging Het
Ttn T C 2: 76,736,399 N28050S possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Wnt3 G A 11: 103,812,315 C208Y probably damaging Het
Zfp521 C A 18: 13,845,268 C696F probably damaging Het
Zfp521 T C 18: 13,846,870 D162G probably damaging Het
Zfp869 A T 8: 69,706,404 H506Q probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4867:Shprh UTSW 10 11164557 missense probably benign 0.00
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
R8995:Shprh UTSW 10 11164830 nonsense probably null
R9053:Shprh UTSW 10 11154702 missense probably benign 0.04
R9131:Shprh UTSW 10 11162845 missense possibly damaging 0.58
R9176:Shprh UTSW 10 11160576 missense probably benign 0.02
R9391:Shprh UTSW 10 11162889 missense probably benign 0.05
R9423:Shprh UTSW 10 11205263 missense probably damaging 1.00
R9563:Shprh UTSW 10 11166491 nonsense probably null
R9668:Shprh UTSW 10 11206332 missense probably damaging 0.97
R9709:Shprh UTSW 10 11162830 missense possibly damaging 0.91
R9718:Shprh UTSW 10 11213504 missense probably damaging 1.00
R9750:Shprh UTSW 10 11164460 missense probably damaging 0.98
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTCCTTGAAGAAAACTGAGCC -3'
(R):5'- CAGTATGATTACTTGCCGTCACCCC -3'

Sequencing Primer
(F):5'- GTGGCTTACAATGCAGACTC -3'
(R):5'- TTGCCGTCACCCCAATAC -3'
Posted On 2013-05-23