Incidental Mutation 'R0494:Shprh'
ID 42665
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene Name SNF2 histone linker PHD RING helicase
Synonyms 2610103K11Rik, D230017O13Rik
MMRRC Submission 038691-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0494 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 11025171-11093339 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 11032935 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 307 (V307A)
Ref Sequence ENSEMBL: ENSMUSP00000125457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810]
AlphaFold Q7TPQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000044053
AA Change: V307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054814
AA Change: V307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159541
AA Change: V307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000159810
AA Change: V307A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: V307A

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161858
Meta Mutation Damage Score 0.8240 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (109/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,402,339 (GRCm39) I116V probably benign Het
Abhd18 T C 3: 40,871,123 (GRCm39) F94S probably damaging Het
Adam28 T A 14: 68,868,241 (GRCm39) probably benign Het
Afg2a G C 3: 37,486,312 (GRCm39) D345H possibly damaging Het
Amn1 A T 6: 149,086,634 (GRCm39) probably benign Het
Arhgap32 T C 9: 32,170,199 (GRCm39) V993A probably damaging Het
Arhgap33 A T 7: 30,223,921 (GRCm39) S703T probably damaging Het
Arhgef1 T C 7: 24,618,785 (GRCm39) probably benign Het
Atg2a A G 19: 6,303,407 (GRCm39) Y1083C probably damaging Het
Atp2a3 T C 11: 72,872,731 (GRCm39) F760L probably damaging Het
B9d1 A G 11: 61,403,271 (GRCm39) probably benign Het
Batf C T 12: 85,733,636 (GRCm39) probably benign Het
BC051019 T A 7: 109,317,182 (GRCm39) Y170F probably benign Het
Bphl T C 13: 34,221,754 (GRCm39) *37Q probably null Het
Cab39l T C 14: 59,737,008 (GRCm39) S43P probably damaging Het
Cad A G 5: 31,234,856 (GRCm39) probably benign Het
Cct4 T G 11: 22,946,014 (GRCm39) S119A probably benign Het
Cd163 G A 6: 124,288,408 (GRCm39) V280M probably damaging Het
Cd86 A G 16: 36,438,999 (GRCm39) probably benign Het
Cdh23 G A 10: 60,152,375 (GRCm39) probably benign Het
Cdhr5 A G 7: 140,852,431 (GRCm39) F145S probably damaging Het
Cdt1 T C 8: 123,298,799 (GRCm39) S479P possibly damaging Het
Ces2g T C 8: 105,693,199 (GRCm39) V372A probably benign Het
Chrna3 T C 9: 54,929,562 (GRCm39) D92G probably damaging Het
Cndp1 A G 18: 84,637,658 (GRCm39) S359P probably benign Het
Cops4 A G 5: 100,676,528 (GRCm39) Q93R probably damaging Het
Dgka G C 10: 128,556,952 (GRCm39) probably benign Het
Dmp1 A T 5: 104,360,074 (GRCm39) D250V probably damaging Het
Dnajb2 C T 1: 75,216,278 (GRCm39) probably benign Het
Dock9 T C 14: 121,899,996 (GRCm39) T113A possibly damaging Het
Egln3 T A 12: 54,250,107 (GRCm39) I81F probably benign Het
Elapor2 G A 5: 9,470,723 (GRCm39) probably null Het
Elovl5 T C 9: 77,868,199 (GRCm39) V37A probably benign Het
Esco1 A T 18: 10,594,940 (GRCm39) N115K probably benign Het
Fat1 A T 8: 45,403,579 (GRCm39) N110I probably damaging Het
Fezf1 T A 6: 23,246,054 (GRCm39) K370N probably damaging Het
Galnt18 T A 7: 111,153,771 (GRCm39) K284N probably damaging Het
Glt8d1 C A 14: 30,733,580 (GRCm39) T355K possibly damaging Het
Gm17455 G A 10: 60,239,014 (GRCm39) R93H possibly damaging Het
Gng8 T A 7: 16,629,213 (GRCm39) D46E probably benign Het
Gpx4 T C 10: 79,892,011 (GRCm39) probably benign Het
Grk2 A T 19: 4,341,347 (GRCm39) N189K probably damaging Het
Grm5 T C 7: 87,779,989 (GRCm39) V1143A probably benign Het
Hibch A G 1: 52,942,055 (GRCm39) E237G possibly damaging Het
Hipk2 C T 6: 38,706,924 (GRCm39) A682T probably benign Het
Hmcn1 G T 1: 150,608,543 (GRCm39) probably benign Het
Htt A G 5: 34,979,188 (GRCm39) D857G possibly damaging Het
Idh2 C T 7: 79,748,005 (GRCm39) A232T probably damaging Het
Igsf8 A G 1: 172,146,265 (GRCm39) E421G probably benign Het
Kif26a T A 12: 112,145,905 (GRCm39) probably null Het
Klhl26 T C 8: 70,904,251 (GRCm39) Y519C probably damaging Het
Lamc1 A C 1: 153,122,682 (GRCm39) probably null Het
Mical3 A T 6: 120,936,162 (GRCm39) S1455T possibly damaging Het
Mitf G A 6: 97,971,390 (GRCm39) G186S probably benign Het
Ms4a15 G A 19: 10,958,722 (GRCm39) probably benign Het
Myo5b A G 18: 74,787,038 (GRCm39) E481G probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nbeal2 C A 9: 110,456,255 (GRCm39) V1686L probably damaging Het
Nedd4l T G 18: 65,306,092 (GRCm39) S335A possibly damaging Het
Nos1 A T 5: 118,043,539 (GRCm39) N605Y probably damaging Het
Nyx C A X: 13,353,508 (GRCm39) T454K probably benign Het
Or52n2 A G 7: 104,542,478 (GRCm39) L119P probably damaging Het
Or8g55 T A 9: 39,784,698 (GRCm39) N42K probably damaging Het
Pcdhb12 T A 18: 37,571,148 (GRCm39) F765I probably benign Het
Pex3 C T 10: 13,403,532 (GRCm39) G330R probably damaging Het
Pfkfb1 T C X: 149,417,609 (GRCm39) Y339H probably damaging Het
Pias1 G A 9: 62,794,593 (GRCm39) Q26* probably null Het
Pik3cg C A 12: 32,254,545 (GRCm39) V481L possibly damaging Het
Plcg2 C T 8: 118,282,843 (GRCm39) T108M probably damaging Het
Pon2 G A 6: 5,267,059 (GRCm39) probably benign Het
Ppef2 A T 5: 92,400,952 (GRCm39) probably benign Het
Pramel21 G T 4: 143,342,726 (GRCm39) V278F probably benign Het
Ptpn22 A G 3: 103,767,771 (GRCm39) K18E probably damaging Het
Pum2 C T 12: 8,771,736 (GRCm39) Q360* probably null Het
Rab10 A C 12: 3,302,723 (GRCm39) probably null Het
Ranbp2 T G 10: 58,303,254 (GRCm39) S809A possibly damaging Het
Rbms2 A G 10: 127,969,539 (GRCm39) V348A probably benign Het
Rnf213 A G 11: 119,316,838 (GRCm39) E988G possibly damaging Het
Rnf213 A T 11: 119,333,946 (GRCm39) M3052L probably damaging Het
Rpl14 C A 9: 120,403,428 (GRCm39) probably benign Het
Rplp0 A G 5: 115,697,931 (GRCm39) Y13C possibly damaging Het
Ryr1 A G 7: 28,703,218 (GRCm39) probably benign Het
Sac3d1 T C 19: 6,168,324 (GRCm39) E98G probably damaging Het
Scn10a T A 9: 119,453,166 (GRCm39) D1242V probably damaging Het
Scnn1b T C 7: 121,498,681 (GRCm39) Y74H probably damaging Het
Serpinb3a C T 1: 106,975,212 (GRCm39) W198* probably null Het
Sf3b4 C A 3: 96,081,017 (GRCm39) D108E probably damaging Het
Slc2a2 A G 3: 28,781,426 (GRCm39) D458G probably benign Het
Strc T C 2: 121,210,014 (GRCm39) D103G probably damaging Het
Synrg T C 11: 83,910,369 (GRCm39) I923T probably benign Het
Tango6 G T 8: 107,462,314 (GRCm39) probably benign Het
Tas2r106 A G 6: 131,655,539 (GRCm39) L104P probably damaging Het
Tat C T 8: 110,718,316 (GRCm39) P67L probably damaging Het
Tln2 A C 9: 67,262,479 (GRCm39) S593A probably benign Het
Tmem94 A G 11: 115,685,607 (GRCm39) probably null Het
Tppp3 G A 8: 106,194,804 (GRCm39) A109V probably benign Het
Trank1 T C 9: 111,220,361 (GRCm39) F2366S probably benign Het
Trpc5 T A X: 143,264,392 (GRCm39) Y155F probably damaging Het
Trpv1 A G 11: 73,151,268 (GRCm39) T451A probably benign Het
Ttc9 C A 12: 81,678,423 (GRCm39) A82E probably damaging Het
Ttll11 T A 2: 35,834,886 (GRCm39) N180I probably damaging Het
Ttn T C 2: 76,566,743 (GRCm39) N28050S possibly damaging Het
Vmn2r73 G T 7: 85,522,140 (GRCm39) H66Q probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Wnt3 G A 11: 103,703,141 (GRCm39) C208Y probably damaging Het
Zfp521 C A 18: 13,978,325 (GRCm39) C696F probably damaging Het
Zfp521 T C 18: 13,979,927 (GRCm39) D162G probably damaging Het
Zfp869 A T 8: 70,159,054 (GRCm39) H506Q probably damaging Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11,063,902 (GRCm39) missense probably damaging 1.00
IGL00583:Shprh APN 10 11,063,764 (GRCm39) missense probably benign 0.37
IGL00684:Shprh APN 10 11,038,781 (GRCm39) missense probably benign 0.11
IGL01295:Shprh APN 10 11,059,612 (GRCm39) missense probably damaging 0.96
IGL01387:Shprh APN 10 11,045,998 (GRCm39) missense probably damaging 1.00
IGL01635:Shprh APN 10 11,045,763 (GRCm39) nonsense probably null
IGL01833:Shprh APN 10 11,066,806 (GRCm39) missense probably damaging 1.00
IGL02013:Shprh APN 10 11,057,246 (GRCm39) splice site probably benign
IGL02502:Shprh APN 10 11,070,101 (GRCm39) missense possibly damaging 0.66
IGL02819:Shprh APN 10 11,030,509 (GRCm39) missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11,068,238 (GRCm39) frame shift probably null
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0010:Shprh UTSW 10 11,027,675 (GRCm39) missense probably benign
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0053:Shprh UTSW 10 11,070,116 (GRCm39) splice site probably null
R0255:Shprh UTSW 10 11,062,135 (GRCm39) missense possibly damaging 0.92
R0325:Shprh UTSW 10 11,045,853 (GRCm39) missense probably benign 0.00
R0331:Shprh UTSW 10 11,069,914 (GRCm39) splice site probably benign
R0532:Shprh UTSW 10 11,038,556 (GRCm39) missense possibly damaging 0.90
R0546:Shprh UTSW 10 11,059,631 (GRCm39) splice site probably benign
R0574:Shprh UTSW 10 11,038,821 (GRCm39) unclassified probably benign
R0605:Shprh UTSW 10 11,082,856 (GRCm39) missense probably damaging 1.00
R0662:Shprh UTSW 10 11,062,591 (GRCm39) missense probably damaging 1.00
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1148:Shprh UTSW 10 11,089,226 (GRCm39) missense possibly damaging 0.95
R1263:Shprh UTSW 10 11,035,274 (GRCm39) missense probably damaging 1.00
R1588:Shprh UTSW 10 11,040,488 (GRCm39) missense probably damaging 1.00
R1638:Shprh UTSW 10 11,032,822 (GRCm39) missense probably benign
R1830:Shprh UTSW 10 11,062,655 (GRCm39) splice site probably null
R1898:Shprh UTSW 10 11,062,613 (GRCm39) missense probably damaging 1.00
R1903:Shprh UTSW 10 11,059,541 (GRCm39) nonsense probably null
R2060:Shprh UTSW 10 11,027,864 (GRCm39) missense probably benign 0.03
R2225:Shprh UTSW 10 11,037,979 (GRCm39) unclassified probably benign
R2363:Shprh UTSW 10 11,047,697 (GRCm39) missense probably damaging 1.00
R2509:Shprh UTSW 10 11,042,468 (GRCm39) missense probably damaging 1.00
R2891:Shprh UTSW 10 11,040,100 (GRCm39) missense probably damaging 1.00
R3077:Shprh UTSW 10 11,046,157 (GRCm39) missense probably damaging 1.00
R3150:Shprh UTSW 10 11,045,774 (GRCm39) missense probably damaging 0.97
R3796:Shprh UTSW 10 11,054,501 (GRCm39) missense possibly damaging 0.89
R4196:Shprh UTSW 10 11,083,604 (GRCm39) utr 3 prime probably benign
R4423:Shprh UTSW 10 11,062,262 (GRCm39) missense possibly damaging 0.82
R4488:Shprh UTSW 10 11,036,215 (GRCm39) missense probably benign 0.17
R4748:Shprh UTSW 10 11,046,220 (GRCm39) missense probably damaging 1.00
R4768:Shprh UTSW 10 11,057,284 (GRCm39) missense probably damaging 0.96
R4867:Shprh UTSW 10 11,040,301 (GRCm39) missense probably benign 0.00
R4937:Shprh UTSW 10 11,032,863 (GRCm39) missense probably benign
R5140:Shprh UTSW 10 11,030,449 (GRCm39) missense probably benign 0.03
R5318:Shprh UTSW 10 11,042,301 (GRCm39) missense probably benign 0.04
R5323:Shprh UTSW 10 11,046,041 (GRCm39) splice site probably null
R5450:Shprh UTSW 10 11,088,074 (GRCm39) missense possibly damaging 0.70
R5872:Shprh UTSW 10 11,063,817 (GRCm39) missense probably damaging 1.00
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6030:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign 0.37
R6392:Shprh UTSW 10 11,054,485 (GRCm39) nonsense probably null
R6416:Shprh UTSW 10 11,043,617 (GRCm39) missense probably damaging 1.00
R6470:Shprh UTSW 10 11,047,681 (GRCm39) missense probably damaging 0.98
R6513:Shprh UTSW 10 11,062,637 (GRCm39) missense probably damaging 1.00
R6530:Shprh UTSW 10 11,070,011 (GRCm39) missense probably benign 0.02
R6678:Shprh UTSW 10 11,042,289 (GRCm39) missense probably benign 0.16
R6757:Shprh UTSW 10 11,057,252 (GRCm39) splice site probably null
R6971:Shprh UTSW 10 11,042,437 (GRCm39) missense probably damaging 1.00
R7158:Shprh UTSW 10 11,042,474 (GRCm39) missense probably damaging 0.98
R7582:Shprh UTSW 10 11,040,449 (GRCm39) missense probably benign
R7757:Shprh UTSW 10 11,037,924 (GRCm39) missense probably benign 0.30
R7812:Shprh UTSW 10 11,027,735 (GRCm39) missense probably benign
R7998:Shprh UTSW 10 11,061,085 (GRCm39) missense probably damaging 1.00
R8061:Shprh UTSW 10 11,088,077 (GRCm39) missense possibly damaging 0.71
R8082:Shprh UTSW 10 11,027,555 (GRCm39) missense probably benign 0.22
R8116:Shprh UTSW 10 11,089,205 (GRCm39) missense probably damaging 0.99
R8390:Shprh UTSW 10 11,063,727 (GRCm39) missense possibly damaging 0.92
R8445:Shprh UTSW 10 11,057,313 (GRCm39) missense possibly damaging 0.92
R8530:Shprh UTSW 10 11,027,678 (GRCm39) missense probably benign 0.37
R8759:Shprh UTSW 10 11,032,908 (GRCm39) missense possibly damaging 0.92
R8937:Shprh UTSW 10 11,061,181 (GRCm39) missense possibly damaging 0.60
R8995:Shprh UTSW 10 11,040,574 (GRCm39) nonsense probably null
R9053:Shprh UTSW 10 11,030,446 (GRCm39) missense probably benign 0.04
R9131:Shprh UTSW 10 11,038,589 (GRCm39) missense possibly damaging 0.58
R9176:Shprh UTSW 10 11,036,320 (GRCm39) missense probably benign 0.02
R9391:Shprh UTSW 10 11,038,633 (GRCm39) missense probably benign 0.05
R9423:Shprh UTSW 10 11,081,007 (GRCm39) missense probably damaging 1.00
R9563:Shprh UTSW 10 11,042,235 (GRCm39) nonsense probably null
R9668:Shprh UTSW 10 11,082,076 (GRCm39) missense probably damaging 0.97
R9709:Shprh UTSW 10 11,038,574 (GRCm39) missense possibly damaging 0.91
R9718:Shprh UTSW 10 11,089,248 (GRCm39) missense probably damaging 1.00
R9750:Shprh UTSW 10 11,040,204 (GRCm39) missense probably damaging 0.98
RF012:Shprh UTSW 10 11,040,585 (GRCm39) missense probably benign 0.02
V8831:Shprh UTSW 10 11,062,606 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,062,191 (GRCm39) missense probably damaging 1.00
Z1176:Shprh UTSW 10 11,040,297 (GRCm39) missense probably benign
Z1177:Shprh UTSW 10 11,027,506 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- CCAGCTCCTTGAAGAAAACTGAGCC -3'
(R):5'- CAGTATGATTACTTGCCGTCACCCC -3'

Sequencing Primer
(F):5'- GTGGCTTACAATGCAGACTC -3'
(R):5'- TTGCCGTCACCCCAATAC -3'
Posted On 2013-05-23