Incidental Mutation 'R5422:Nalcn'
ID 426665
Institutional Source Beutler Lab
Gene Symbol Nalcn
Ensembl Gene ENSMUSG00000000197
Gene Name sodium leak channel, non-selective
Synonyms Vgcnl1, A530023G15Rik
MMRRC Submission 042846-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5422 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 123514046-123864556 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 123752777 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 328 (I328N)
Ref Sequence ENSEMBL: ENSMUSP00000000201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000201]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000000201
AA Change: I328N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000201
Gene: ENSMUSG00000000197
AA Change: I328N

DomainStartEndE-ValueType
Pfam:Ion_trans 35 333 2.8e-37 PFAM
low complexity region 338 348 N/A INTRINSIC
Pfam:Ion_trans 383 609 5.7e-34 PFAM
coiled coil region 796 830 N/A INTRINSIC
Pfam:Ion_trans 885 1166 2.4e-42 PFAM
Pfam:Ion_trans 1209 1458 6.9e-30 PFAM
low complexity region 1548 1560 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226617
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228860
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NALCN forms a voltage-independent, nonselective, noninactivating cation channel permeable to Na+, K+, and Ca(2+). It is responsible for the neuronal background sodium leak conductance (Lu et al., 2007 [PubMed 17448995]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal breathing at birth and die within 24 hours. Mice homozygous for a gain of function ENU mutation exhibit reduced the total amount and episode duration of REMS. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 114,425,606 (GRCm39) S1219G probably benign Het
Adgrg5 T A 8: 95,660,580 (GRCm39) I73N probably damaging Het
Agmat C A 4: 141,483,144 (GRCm39) H193N probably damaging Het
Ambn T C 5: 88,612,370 (GRCm39) probably null Het
Atp8b5 T A 4: 43,366,644 (GRCm39) C803S probably benign Het
Btaf1 A T 19: 36,928,507 (GRCm39) R109S probably benign Het
Btnl6 C T 17: 34,733,081 (GRCm39) G261R possibly damaging Het
Clk3 A G 9: 57,672,721 (GRCm39) V27A probably benign Het
Clu A G 14: 66,213,051 (GRCm39) S146G probably damaging Het
Cyp2w1 T C 5: 139,338,528 (GRCm39) F43L probably benign Het
Elf3 C T 1: 135,182,778 (GRCm39) E316K probably damaging Het
Epha5 A T 5: 84,479,349 (GRCm39) D218E probably damaging Het
Ereg T C 5: 91,222,666 (GRCm39) probably null Het
Ewsr1 A G 11: 5,030,668 (GRCm39) probably benign Het
Fat4 A G 3: 38,941,394 (GRCm39) I96V possibly damaging Het
Fgl2 T G 5: 21,580,808 (GRCm39) N383K probably damaging Het
Fkbp11 A T 15: 98,625,989 (GRCm39) probably null Het
Fn3k C A 11: 121,340,948 (GRCm39) P201Q probably damaging Het
Fsip2 A G 2: 82,812,572 (GRCm39) I2964V probably benign Het
Gbx1 C T 5: 24,709,667 (GRCm39) V393I possibly damaging Het
Gch1 C T 14: 47,394,906 (GRCm39) A187T probably damaging Het
Ghdc C A 11: 100,660,020 (GRCm39) K242N probably benign Het
Ghrhr A G 6: 55,365,188 (GRCm39) H394R probably benign Het
Gje1 G A 10: 14,592,428 (GRCm39) S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,442,208 (GRCm39) S236R probably benign Het
Kcnj5 A G 9: 32,229,001 (GRCm39) Y66H probably benign Het
Kif15 T A 9: 122,813,954 (GRCm39) probably null Het
Magi3 C T 3: 103,958,684 (GRCm39) C467Y probably damaging Het
Map7 G T 10: 20,142,512 (GRCm39) V303F probably damaging Het
Mapk11 A G 15: 89,030,488 (GRCm39) L135P probably damaging Het
Mapkapk5 T A 5: 121,669,785 (GRCm39) probably null Het
Myh7b A C 2: 155,472,954 (GRCm39) Q1405P probably damaging Het
Nprl2 C A 9: 107,420,796 (GRCm39) R144S probably benign Het
Ogfr G T 2: 180,237,067 (GRCm39) D551Y possibly damaging Het
Ogfr A T 2: 180,237,068 (GRCm39) D551V probably benign Het
Or6b13 A T 7: 139,782,305 (GRCm39) V126E probably damaging Het
Or8c10 A T 9: 38,279,270 (GRCm39) T143S probably benign Het
Parp14 T C 16: 35,686,545 (GRCm39) K101E probably benign Het
Pcdhb16 A T 18: 37,612,920 (GRCm39) T627S probably damaging Het
Pdzrn4 G A 15: 92,575,502 (GRCm39) G303S probably benign Het
Plcl1 A T 1: 55,736,543 (GRCm39) Y628F probably benign Het
Ptpn9 T A 9: 56,940,441 (GRCm39) W194R probably damaging Het
Ranbp9 A T 13: 43,573,102 (GRCm39) M474K probably benign Het
Rasgef1a T A 6: 118,065,095 (GRCm39) F370Y probably damaging Het
Rassf5 C A 1: 131,108,911 (GRCm39) R218L possibly damaging Het
Scart1 A T 7: 139,804,068 (GRCm39) H422L probably benign Het
Serpine2 C A 1: 79,794,592 (GRCm39) V114L probably benign Het
Serpine2 T C 1: 79,799,206 (GRCm39) Y16C probably benign Het
Sgms1 G T 19: 32,137,232 (GRCm39) N111K probably damaging Het
Sh3bp5 C A 14: 31,099,452 (GRCm39) R265L probably benign Het
Slc45a2 C T 15: 11,027,871 (GRCm39) T480I probably damaging Het
Tbc1d17 A T 7: 44,498,292 (GRCm39) M1K probably null Het
Tcf12 A T 9: 71,776,320 (GRCm39) H403Q probably damaging Het
Thoc2l T C 5: 104,667,512 (GRCm39) I678T probably damaging Het
Thsd7b T C 1: 129,849,071 (GRCm39) S928P probably benign Het
Tjp1 A T 7: 64,952,715 (GRCm39) F1540I probably damaging Het
Tph2 T A 10: 114,915,669 (GRCm39) D457V possibly damaging Het
Usp9y T C Y: 1,314,676 (GRCm39) I2112V probably benign Het
Vps51 T G 19: 6,121,063 (GRCm39) E283D probably benign Het
Zfp335 T C 2: 164,749,650 (GRCm39) K249R probably damaging Het
Zfp54 C A 17: 21,654,788 (GRCm39) S427R probably benign Het
Zfp607b A G 7: 27,401,813 (GRCm39) T90A probably benign Het
Other mutations in Nalcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00952:Nalcn APN 14 123,586,201 (GRCm39) missense probably benign 0.00
IGL00964:Nalcn APN 14 123,532,796 (GRCm39) splice site probably benign
IGL01310:Nalcn APN 14 123,554,661 (GRCm39) missense probably benign 0.00
IGL01578:Nalcn APN 14 123,809,503 (GRCm39) missense probably benign 0.00
IGL01925:Nalcn APN 14 123,529,260 (GRCm39) missense possibly damaging 0.88
IGL02072:Nalcn APN 14 123,560,770 (GRCm39) missense probably benign 0.05
IGL02096:Nalcn APN 14 123,831,915 (GRCm39) missense probably benign 0.11
IGL02212:Nalcn APN 14 123,752,742 (GRCm39) missense probably damaging 0.99
IGL02306:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02471:Nalcn APN 14 123,560,726 (GRCm39) missense probably benign 0.02
IGL02478:Nalcn APN 14 123,558,717 (GRCm39) missense probably benign 0.26
IGL02551:Nalcn APN 14 123,560,750 (GRCm39) missense probably benign 0.07
IGL02630:Nalcn APN 14 123,555,291 (GRCm39) missense probably benign 0.16
IGL02632:Nalcn APN 14 123,555,265 (GRCm39) missense probably benign 0.11
IGL02661:Nalcn APN 14 123,830,321 (GRCm39) splice site probably benign
IGL02830:Nalcn APN 14 123,530,881 (GRCm39) missense probably damaging 0.98
IGL02939:Nalcn APN 14 123,536,284 (GRCm39) missense probably null 1.00
IGL03035:Nalcn APN 14 123,515,630 (GRCm39) nonsense probably null
IGL03226:Nalcn APN 14 123,518,527 (GRCm39) missense probably benign 0.00
IGL03242:Nalcn APN 14 123,558,899 (GRCm39) missense possibly damaging 0.91
Narnia UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0019:Nalcn UTSW 14 123,744,901 (GRCm39) missense probably benign 0.18
R0144:Nalcn UTSW 14 123,647,251 (GRCm39) splice site probably benign
R0144:Nalcn UTSW 14 123,608,948 (GRCm39) missense probably damaging 0.96
R0359:Nalcn UTSW 14 123,536,580 (GRCm39) missense probably damaging 1.00
R0383:Nalcn UTSW 14 123,744,971 (GRCm39) missense probably benign 0.01
R0400:Nalcn UTSW 14 123,528,372 (GRCm39) splice site probably benign
R0467:Nalcn UTSW 14 123,528,459 (GRCm39) missense probably benign 0.11
R0506:Nalcn UTSW 14 123,834,026 (GRCm39) missense possibly damaging 0.82
R0583:Nalcn UTSW 14 123,531,755 (GRCm39) missense possibly damaging 0.46
R0620:Nalcn UTSW 14 123,536,553 (GRCm39) splice site probably benign
R0624:Nalcn UTSW 14 123,607,444 (GRCm39) missense probably benign
R0883:Nalcn UTSW 14 123,702,152 (GRCm39) missense probably damaging 1.00
R1381:Nalcn UTSW 14 123,551,517 (GRCm39) missense probably damaging 1.00
R1467:Nalcn UTSW 14 123,702,068 (GRCm39) splice site probably benign
R1689:Nalcn UTSW 14 123,522,666 (GRCm39) missense probably damaging 1.00
R1726:Nalcn UTSW 14 123,545,816 (GRCm39) missense probably damaging 1.00
R1774:Nalcn UTSW 14 123,515,678 (GRCm39) missense probably benign
R1854:Nalcn UTSW 14 123,697,824 (GRCm39) missense probably damaging 1.00
R1869:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1871:Nalcn UTSW 14 123,831,965 (GRCm39) missense possibly damaging 0.96
R1873:Nalcn UTSW 14 123,521,013 (GRCm39) missense probably benign 0.00
R1899:Nalcn UTSW 14 123,553,538 (GRCm39) missense possibly damaging 0.50
R1915:Nalcn UTSW 14 123,540,181 (GRCm39) missense probably benign 0.08
R2016:Nalcn UTSW 14 123,831,993 (GRCm39) splice site probably null
R2034:Nalcn UTSW 14 123,521,015 (GRCm39) missense probably benign 0.01
R2087:Nalcn UTSW 14 123,518,557 (GRCm39) missense probably benign
R2149:Nalcn UTSW 14 123,607,429 (GRCm39) missense probably benign 0.01
R2157:Nalcn UTSW 14 123,647,164 (GRCm39) missense probably benign 0.32
R2166:Nalcn UTSW 14 123,607,363 (GRCm39) missense probably benign 0.00
R2932:Nalcn UTSW 14 123,830,430 (GRCm39) missense probably benign 0.06
R3408:Nalcn UTSW 14 123,834,029 (GRCm39) missense probably null 0.98
R3778:Nalcn UTSW 14 123,702,128 (GRCm39) missense probably damaging 1.00
R3807:Nalcn UTSW 14 123,515,599 (GRCm39) missense probably damaging 1.00
R3835:Nalcn UTSW 14 123,530,834 (GRCm39) splice site probably benign
R3937:Nalcn UTSW 14 123,607,357 (GRCm39) missense probably benign 0.00
R4001:Nalcn UTSW 14 123,834,006 (GRCm39) missense probably damaging 1.00
R4015:Nalcn UTSW 14 123,723,799 (GRCm39) missense probably damaging 1.00
R4033:Nalcn UTSW 14 123,837,401 (GRCm39) splice site probably benign
R4231:Nalcn UTSW 14 123,837,325 (GRCm39) missense probably benign 0.01
R4464:Nalcn UTSW 14 123,560,762 (GRCm39) missense probably benign
R4512:Nalcn UTSW 14 123,532,860 (GRCm39) missense probably damaging 1.00
R4542:Nalcn UTSW 14 123,558,889 (GRCm39) synonymous silent
R4557:Nalcn UTSW 14 123,558,647 (GRCm39) intron probably benign
R4869:Nalcn UTSW 14 123,837,296 (GRCm39) missense probably benign 0.44
R5083:Nalcn UTSW 14 123,560,706 (GRCm39) splice site probably null
R5109:Nalcn UTSW 14 123,515,650 (GRCm39) missense possibly damaging 0.86
R5131:Nalcn UTSW 14 123,753,182 (GRCm39) missense probably damaging 0.98
R5158:Nalcn UTSW 14 123,753,149 (GRCm39) missense probably damaging 1.00
R5259:Nalcn UTSW 14 123,753,063 (GRCm39) missense possibly damaging 0.94
R5514:Nalcn UTSW 14 123,521,123 (GRCm39) missense probably benign 0.14
R5523:Nalcn UTSW 14 123,647,155 (GRCm39) missense probably damaging 1.00
R5551:Nalcn UTSW 14 123,515,698 (GRCm39) missense possibly damaging 0.57
R5667:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5671:Nalcn UTSW 14 123,532,818 (GRCm39) missense probably damaging 1.00
R5750:Nalcn UTSW 14 123,809,450 (GRCm39) missense probably benign
R5765:Nalcn UTSW 14 123,702,138 (GRCm39) missense possibly damaging 0.46
R6324:Nalcn UTSW 14 123,647,161 (GRCm39) missense possibly damaging 0.83
R6523:Nalcn UTSW 14 123,555,255 (GRCm39) missense probably benign 0.00
R6558:Nalcn UTSW 14 123,723,919 (GRCm39) missense probably benign
R6631:Nalcn UTSW 14 123,697,663 (GRCm39) missense probably benign 0.17
R6667:Nalcn UTSW 14 123,558,735 (GRCm39) missense probably damaging 1.00
R6670:Nalcn UTSW 14 123,702,084 (GRCm39) missense possibly damaging 0.96
R6724:Nalcn UTSW 14 123,535,479 (GRCm39) missense probably damaging 0.99
R6731:Nalcn UTSW 14 123,837,346 (GRCm39) missense probably benign 0.22
R6957:Nalcn UTSW 14 123,744,966 (GRCm39) missense probably damaging 0.96
R6970:Nalcn UTSW 14 123,551,506 (GRCm39) missense possibly damaging 0.46
R7010:Nalcn UTSW 14 123,530,877 (GRCm39) missense probably damaging 1.00
R7018:Nalcn UTSW 14 123,647,233 (GRCm39) missense probably damaging 1.00
R7040:Nalcn UTSW 14 123,525,267 (GRCm39) missense probably benign
R7089:Nalcn UTSW 14 123,515,761 (GRCm39) missense probably benign 0.01
R7128:Nalcn UTSW 14 123,831,914 (GRCm39) missense probably damaging 0.99
R7149:Nalcn UTSW 14 123,837,277 (GRCm39) missense probably benign 0.02
R7361:Nalcn UTSW 14 123,529,251 (GRCm39) missense probably benign 0.00
R7378:Nalcn UTSW 14 123,540,302 (GRCm39) missense probably damaging 1.00
R7408:Nalcn UTSW 14 123,529,272 (GRCm39) missense probably benign 0.00
R7470:Nalcn UTSW 14 123,809,456 (GRCm39) missense probably benign 0.09
R7483:Nalcn UTSW 14 123,551,499 (GRCm39) missense probably damaging 1.00
R7521:Nalcn UTSW 14 123,530,870 (GRCm39) missense probably damaging 1.00
R7558:Nalcn UTSW 14 123,723,797 (GRCm39) critical splice donor site probably null
R7585:Nalcn UTSW 14 123,753,050 (GRCm39) missense probably damaging 1.00
R7591:Nalcn UTSW 14 123,561,297 (GRCm39) missense probably benign 0.01
R7761:Nalcn UTSW 14 123,531,792 (GRCm39) missense probably damaging 1.00
R7761:Nalcn UTSW 14 123,531,791 (GRCm39) missense probably damaging 1.00
R7811:Nalcn UTSW 14 123,536,357 (GRCm39) missense probably damaging 1.00
R7983:Nalcn UTSW 14 123,830,409 (GRCm39) missense probably benign 0.17
R8089:Nalcn UTSW 14 123,537,372 (GRCm39) missense probably damaging 1.00
R8110:Nalcn UTSW 14 123,702,113 (GRCm39) missense probably benign 0.00
R8190:Nalcn UTSW 14 123,837,351 (GRCm39) missense possibly damaging 0.69
R8273:Nalcn UTSW 14 123,554,436 (GRCm39) missense probably damaging 1.00
R8407:Nalcn UTSW 14 123,554,683 (GRCm39) missense probably damaging 1.00
R8497:Nalcn UTSW 14 123,752,771 (GRCm39) missense probably damaging 1.00
R8544:Nalcn UTSW 14 123,608,935 (GRCm39) missense probably benign 0.40
R8549:Nalcn UTSW 14 123,607,448 (GRCm39) missense probably benign 0.01
R8731:Nalcn UTSW 14 123,837,266 (GRCm39) missense probably benign 0.01
R8862:Nalcn UTSW 14 123,647,199 (GRCm39) missense possibly damaging 0.96
R8919:Nalcn UTSW 14 123,561,284 (GRCm39) missense probably benign 0.00
R9072:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9073:Nalcn UTSW 14 123,532,863 (GRCm39) missense possibly damaging 0.66
R9182:Nalcn UTSW 14 123,834,016 (GRCm39) missense probably damaging 1.00
R9193:Nalcn UTSW 14 123,545,792 (GRCm39) nonsense probably null
R9241:Nalcn UTSW 14 123,809,429 (GRCm39) missense probably benign 0.00
R9267:Nalcn UTSW 14 123,518,567 (GRCm39) missense probably benign 0.08
R9274:Nalcn UTSW 14 123,753,068 (GRCm39) missense probably damaging 1.00
R9277:Nalcn UTSW 14 123,518,523 (GRCm39) missense probably damaging 0.98
R9376:Nalcn UTSW 14 123,515,713 (GRCm39) missense possibly damaging 0.74
X0060:Nalcn UTSW 14 123,522,653 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,831,980 (GRCm39) missense probably damaging 1.00
Z1177:Nalcn UTSW 14 123,531,857 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGTAGCATCCCGTTACAGC -3'
(R):5'- CACATGTAGCCTGGCTTATCAAG -3'

Sequencing Primer
(F):5'- GTTACAGCAGCATTCCCTGG -3'
(R):5'- CTATACTTAGAGCACATGTAGCCGG -3'
Posted On 2016-09-01