Incidental Mutation 'R5422:Mapk11'
ID426667
Institutional Source Beutler Lab
Gene Symbol Mapk11
Ensembl Gene ENSMUSG00000053137
Gene Namemitogen-activated protein kinase 11
SynonymsP38b, p38beta, Prkm11, Sapk2
MMRRC Submission 042846-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5422 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89142486-89149628 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 89146285 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 135 (L135P)
Ref Sequence ENSEMBL: ENSMUSP00000086204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088823]
Predicted Effect probably damaging
Transcript: ENSMUST00000088823
AA Change: L135P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086204
Gene: ENSMUSG00000053137
AA Change: L135P

DomainStartEndE-ValueType
S_TKc 24 308 1.67e-84 SMART
low complexity region 313 325 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230734
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of protein kinases that are involved in the integration of biochemical signals for a wide variety of cellular processes, including cell proliferation, differentiation, transcriptional regulation, and development. The encoded protein can be activated by proinflammatory cytokines and environmental stresses through phosphorylation by mitogen activated protein kinase kinases (MKKs). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,698,974 S1219G probably benign Het
Adgrg5 T A 8: 94,933,952 I73N probably damaging Het
Agmat C A 4: 141,755,833 H193N probably damaging Het
Ambn T C 5: 88,464,511 probably null Het
Atp8b5 T A 4: 43,366,644 C803S probably benign Het
BC005561 T C 5: 104,519,646 I678T probably damaging Het
Btaf1 A T 19: 36,951,107 R109S probably benign Het
Btnl6 C T 17: 34,514,107 G261R possibly damaging Het
Cd163l1 A T 7: 140,224,155 H422L probably benign Het
Clk3 A G 9: 57,765,438 V27A probably benign Het
Clu A G 14: 65,975,602 S146G probably damaging Het
Cyp2w1 T C 5: 139,352,773 F43L probably benign Het
Elf3 C T 1: 135,255,040 E316K probably damaging Het
Epha5 A T 5: 84,331,490 D218E probably damaging Het
Ereg T C 5: 91,074,807 probably null Het
Ewsr1 A G 11: 5,080,668 probably benign Het
Fat4 A G 3: 38,887,245 I96V possibly damaging Het
Fgl2 T G 5: 21,375,810 N383K probably damaging Het
Fkbp11 A T 15: 98,728,108 probably null Het
Fn3k C A 11: 121,450,122 P201Q probably damaging Het
Fsip2 A G 2: 82,982,228 I2964V probably benign Het
Gbx1 C T 5: 24,504,669 V393I possibly damaging Het
Gch1 C T 14: 47,157,449 A187T probably damaging Het
Ghdc C A 11: 100,769,194 K242N probably benign Het
Ghrhr A G 6: 55,388,203 H394R probably benign Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,465,228 S236R probably benign Het
Kcnj5 A G 9: 32,317,705 Y66H probably benign Het
Kif15 T A 9: 122,984,889 probably null Het
Magi3 C T 3: 104,051,368 C467Y probably damaging Het
Map7 G T 10: 20,266,766 V303F probably damaging Het
Mapkapk5 T A 5: 121,531,722 probably null Het
Myh7b A C 2: 155,631,034 Q1405P probably damaging Het
Nalcn A T 14: 123,515,365 I328N probably damaging Het
Nprl2 C A 9: 107,543,597 R144S probably benign Het
Ogfr G T 2: 180,595,274 D551Y possibly damaging Het
Ogfr A T 2: 180,595,275 D551V probably benign Het
Olfr250 A T 9: 38,367,974 T143S probably benign Het
Olfr524 A T 7: 140,202,392 V126E probably damaging Het
Parp14 T C 16: 35,866,175 K101E probably benign Het
Pcdhb16 A T 18: 37,479,867 T627S probably damaging Het
Pdzrn4 G A 15: 92,677,621 G303S probably benign Het
Plcl1 A T 1: 55,697,384 Y628F probably benign Het
Ptpn9 T A 9: 57,033,157 W194R probably damaging Het
Ranbp9 A T 13: 43,419,626 M474K probably benign Het
Rasgef1a T A 6: 118,088,134 F370Y probably damaging Het
Rassf5 C A 1: 131,181,174 R218L possibly damaging Het
Serpine2 C A 1: 79,816,875 V114L probably benign Het
Serpine2 T C 1: 79,821,489 Y16C probably benign Het
Sgms1 G T 19: 32,159,832 N111K probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tbc1d17 A T 7: 44,848,868 M1K probably null Het
Tcf12 A T 9: 71,869,038 H403Q probably damaging Het
Thsd7b T C 1: 129,921,334 S928P probably benign Het
Tjp1 A T 7: 65,302,967 F1540I probably damaging Het
Tph2 T A 10: 115,079,764 D457V possibly damaging Het
Usp9y T C Y: 1,314,676 I2112V probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp335 T C 2: 164,907,730 K249R probably damaging Het
Zfp54 C A 17: 21,434,526 S427R probably benign Het
Zfp607b A G 7: 27,702,388 T90A probably benign Het
Other mutations in Mapk11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Mapk11 APN 15 89146843 splice site probably benign
IGL02164:Mapk11 APN 15 89145448 critical splice acceptor site probably null
IGL02825:Mapk11 APN 15 89146382 missense probably damaging 1.00
E0370:Mapk11 UTSW 15 89146513 missense probably damaging 1.00
R1764:Mapk11 UTSW 15 89144391 critical splice donor site probably null
R2158:Mapk11 UTSW 15 89146372 missense probably damaging 0.98
R3149:Mapk11 UTSW 15 89145450 unclassified probably null
R3150:Mapk11 UTSW 15 89145450 unclassified probably null
R3730:Mapk11 UTSW 15 89145115 missense probably benign 0.27
R4319:Mapk11 UTSW 15 89146743 missense probably damaging 1.00
R4424:Mapk11 UTSW 15 89145373 critical splice donor site probably null
R4632:Mapk11 UTSW 15 89146376 missense probably damaging 1.00
R4783:Mapk11 UTSW 15 89149488 missense probably damaging 0.98
R4937:Mapk11 UTSW 15 89146482 missense probably benign
R5511:Mapk11 UTSW 15 89145177 critical splice acceptor site probably null
R5914:Mapk11 UTSW 15 89145835 missense probably benign 0.21
R5972:Mapk11 UTSW 15 89144184 missense probably benign 0.34
R7290:Mapk11 UTSW 15 89144308 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACATTGCTGGGCTTCAGG -3'
(R):5'- TTTCAGCGAAGTGTGAGCG -3'

Sequencing Primer
(F):5'- TAGGCAGAGTGGATGACCCTC -3'
(R):5'- AGCGAAGTGTGAGCGTCCTG -3'
Posted On2016-09-01