Incidental Mutation 'R5422:Btnl6'
ID 426673
Institutional Source Beutler Lab
Gene Symbol Btnl6
Ensembl Gene ENSMUSG00000092618
Gene Name butyrophilin-like 6
Synonyms Gm6519, NG13
MMRRC Submission 042846-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock # R5422 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34507804-34517352 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34514107 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Arginine at position 261 (G261R)
Ref Sequence ENSEMBL: ENSMUSP00000074927 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075483]
AlphaFold A2CG22
Predicted Effect possibly damaging
Transcript: ENSMUST00000075483
AA Change: G261R

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074927
Gene: ENSMUSG00000092618
AA Change: G261R

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 37 145 2.06e-5 SMART
SCOP:d1c5ch2 151 222 1e-2 SMART
Blast:IG_like 152 228 2e-23 BLAST
transmembrane domain 252 271 N/A INTRINSIC
low complexity region 312 326 N/A INTRINSIC
SPRY 384 509 1.23e-19 SMART
low complexity region 510 539 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173164
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts18 T C 8: 113,698,974 S1219G probably benign Het
Adgrg5 T A 8: 94,933,952 I73N probably damaging Het
Agmat C A 4: 141,755,833 H193N probably damaging Het
Ambn T C 5: 88,464,511 probably null Het
Atp8b5 T A 4: 43,366,644 C803S probably benign Het
BC005561 T C 5: 104,519,646 I678T probably damaging Het
Btaf1 A T 19: 36,951,107 R109S probably benign Het
Cd163l1 A T 7: 140,224,155 H422L probably benign Het
Clk3 A G 9: 57,765,438 V27A probably benign Het
Clu A G 14: 65,975,602 S146G probably damaging Het
Cyp2w1 T C 5: 139,352,773 F43L probably benign Het
Elf3 C T 1: 135,255,040 E316K probably damaging Het
Epha5 A T 5: 84,331,490 D218E probably damaging Het
Ereg T C 5: 91,074,807 probably null Het
Ewsr1 A G 11: 5,080,668 probably benign Het
Fat4 A G 3: 38,887,245 I96V possibly damaging Het
Fgl2 T G 5: 21,375,810 N383K probably damaging Het
Fkbp11 A T 15: 98,728,108 probably null Het
Fn3k C A 11: 121,450,122 P201Q probably damaging Het
Fsip2 A G 2: 82,982,228 I2964V probably benign Het
Gbx1 C T 5: 24,504,669 V393I possibly damaging Het
Gch1 C T 14: 47,157,449 A187T probably damaging Het
Ghdc C A 11: 100,769,194 K242N probably benign Het
Ghrhr A G 6: 55,388,203 H394R probably benign Het
Gje1 G A 10: 14,716,684 S118L probably damaging Het
Hnrnpa2b1 A T 6: 51,465,228 S236R probably benign Het
Kcnj5 A G 9: 32,317,705 Y66H probably benign Het
Kif15 T A 9: 122,984,889 probably null Het
Magi3 C T 3: 104,051,368 C467Y probably damaging Het
Map7 G T 10: 20,266,766 V303F probably damaging Het
Mapk11 A G 15: 89,146,285 L135P probably damaging Het
Mapkapk5 T A 5: 121,531,722 probably null Het
Myh7b A C 2: 155,631,034 Q1405P probably damaging Het
Nalcn A T 14: 123,515,365 I328N probably damaging Het
Nprl2 C A 9: 107,543,597 R144S probably benign Het
Ogfr G T 2: 180,595,274 D551Y possibly damaging Het
Ogfr A T 2: 180,595,275 D551V probably benign Het
Olfr250 A T 9: 38,367,974 T143S probably benign Het
Olfr524 A T 7: 140,202,392 V126E probably damaging Het
Parp14 T C 16: 35,866,175 K101E probably benign Het
Pcdhb16 A T 18: 37,479,867 T627S probably damaging Het
Pdzrn4 G A 15: 92,677,621 G303S probably benign Het
Plcl1 A T 1: 55,697,384 Y628F probably benign Het
Ptpn9 T A 9: 57,033,157 W194R probably damaging Het
Ranbp9 A T 13: 43,419,626 M474K probably benign Het
Rasgef1a T A 6: 118,088,134 F370Y probably damaging Het
Rassf5 C A 1: 131,181,174 R218L possibly damaging Het
Serpine2 C A 1: 79,816,875 V114L probably benign Het
Serpine2 T C 1: 79,821,489 Y16C probably benign Het
Sgms1 G T 19: 32,159,832 N111K probably damaging Het
Sh3bp5 C A 14: 31,377,495 R265L probably benign Het
Slc45a2 C T 15: 11,027,785 T480I probably damaging Het
Tbc1d17 A T 7: 44,848,868 M1K probably null Het
Tcf12 A T 9: 71,869,038 H403Q probably damaging Het
Thsd7b T C 1: 129,921,334 S928P probably benign Het
Tjp1 A T 7: 65,302,967 F1540I probably damaging Het
Tph2 T A 10: 115,079,764 D457V possibly damaging Het
Usp9y T C Y: 1,314,676 I2112V probably benign Het
Vps51 T G 19: 6,071,033 E283D probably benign Het
Zfp335 T C 2: 164,907,730 K249R probably damaging Het
Zfp54 C A 17: 21,434,526 S427R probably benign Het
Zfp607b A G 7: 27,702,388 T90A probably benign Het
Other mutations in Btnl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02127:Btnl6 APN 17 34514043 missense probably benign 0.00
IGL02501:Btnl6 APN 17 34515674 missense possibly damaging 0.82
IGL02539:Btnl6 APN 17 34508314 missense probably benign 0.00
IGL02629:Btnl6 APN 17 34514468 missense probably damaging 1.00
IGL02724:Btnl6 APN 17 34508175 nonsense probably null
IGL03366:Btnl6 APN 17 34508179 missense probably damaging 1.00
R0013:Btnl6 UTSW 17 34515531 nonsense probably null
R0025:Btnl6 UTSW 17 34514299 missense probably benign 0.02
R0144:Btnl6 UTSW 17 34514020 missense probably benign 0.29
R0255:Btnl6 UTSW 17 34508503 missense probably benign 0.01
R1474:Btnl6 UTSW 17 34513646 missense probably damaging 1.00
R1757:Btnl6 UTSW 17 34514088 missense probably benign 0.09
R1838:Btnl6 UTSW 17 34515542 missense probably damaging 0.99
R2149:Btnl6 UTSW 17 34514347 missense possibly damaging 0.47
R2994:Btnl6 UTSW 17 34515524 missense possibly damaging 0.82
R3441:Btnl6 UTSW 17 34508318 missense probably benign 0.06
R3809:Btnl6 UTSW 17 34508228 missense probably benign 0.00
R3936:Btnl6 UTSW 17 34517342 missense probably benign
R4462:Btnl6 UTSW 17 34508057 missense probably damaging 1.00
R4604:Btnl6 UTSW 17 34508461 missense possibly damaging 0.91
R4618:Btnl6 UTSW 17 34514146 missense probably damaging 0.98
R4832:Btnl6 UTSW 17 34513992 missense possibly damaging 0.80
R5369:Btnl6 UTSW 17 34507985 nonsense probably null
R6046:Btnl6 UTSW 17 34508397 missense probably damaging 1.00
R6170:Btnl6 UTSW 17 34515506 missense probably damaging 0.99
R6385:Btnl6 UTSW 17 34508369 missense probably benign 0.01
R8213:Btnl6 UTSW 17 34508883 splice site probably null
R8676:Btnl6 UTSW 17 34508069 missense probably benign 0.00
R8895:Btnl6 UTSW 17 34515417 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACCTAAAGGACTCCAGTTGTC -3'
(R):5'- AAGCCATGGCCATGTTCCTC -3'

Sequencing Primer
(F):5'- GAACACTGGACCCTCCTCG -3'
(R):5'- CATGTTCCTCCCAGGTGAGTG -3'
Posted On 2016-09-01