Mutagenetix > Incidental Mutation

Incidental Mutation 'R5423:Rnf20'

426689

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

042989-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5423 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49644620 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 295 (V295A)

Ref Sequence

ENSEMBL: ENSMUSP00000118293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029989
AA Change: V295A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: V295A

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132782

Predicted Effect

probably benign
Transcript: ENSMUST00000146547

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

probably damaging
Transcript: ENSMUST00000156314
AA Change: V295A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: V295A

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000167496
AA Change: V295A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: V295A

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Meta Mutation Damage Score

0.0633

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Adamts9	A	G	6: 92,880,697	I289T	possibly damaging	Het
Ak4	T	G	4: 101,460,563	I110S	probably damaging	Het
Arhgap9	T	G	10: 127,329,549	I609S	probably damaging	Het
Arid4a	C	A	12: 71,069,860	S242*	probably null	Het
Ceacam1	T	G	7: 25,474,526	I235L	probably benign	Het
Chil3	T	C	3: 106,148,662	D365G	probably damaging	Het
Ckap2	A	C	8: 22,177,196	S216R	probably benign	Het
Cyp2e1	G	T	7: 140,770,118	V239L	probably benign	Het
Dnah7b	T	A	1: 46,358,271	M3954K	probably benign	Het
Ercc6l2	A	T	13: 63,872,258		probably benign	Het
Etv5	T	C	16: 22,383,654	D468G	probably damaging	Het
Fbxo44	T	A	4: 148,154,229	I213F	probably benign	Het
Gm5084	A	G	13: 60,212,542		noncoding transcript	Het
Gm5724	T	A	6: 141,744,462	K188N	probably damaging	Het
Gpr17	G	A	18: 31,947,641	T123I	probably damaging	Het
Grin3a	A	G	4: 49,770,376		probably benign	Het
H2-D1	T	G	17: 35,265,907	L248R	probably damaging	Het
Hmcn1	T	C	1: 150,701,972	I2013V	probably damaging	Het
Hp1bp3	A	T	4: 138,225,897	D84V	probably damaging	Het
Ift140	T	C	17: 25,033,085	F33S	probably damaging	Het
Inhbc	C	G	10: 127,357,427	C240S	probably damaging	Het
Iqgap1	T	A	7: 80,799,862	E62V	probably damaging	Het
Kcna4	G	A	2: 107,295,806	W295*	probably null	Het
Kdm4a	C	T	4: 118,138,908	A975T	probably damaging	Het
Lrrtm3	T	C	10: 64,088,152	D412G	possibly damaging	Het
Midn	A	C	10: 80,155,193	I346L	probably benign	Het
Ndufa10	C	T	1: 92,462,320	D259N	probably benign	Het
Nefh	C	A	11: 4,940,985	A545S	possibly damaging	Het
Prpf8	A	G	11: 75,508,958	Y2281C	probably damaging	Het
Psip1	G	A	4: 83,460,130		probably benign	Het
Ptpro	G	T	6: 137,442,707	A184S	probably damaging	Het
Rab37	T	A	11: 115,157,027	I65K	possibly damaging	Het
Rasgrp4	T	C	7: 29,145,136	L247P	probably damaging	Het
Serpina3g	A	G	12: 104,237,994		probably benign	Het
Shox2	A	G	3: 66,973,754		probably benign	Het
Skint6	T	G	4: 112,850,740	D977A	possibly damaging	Het
Slc25a23	C	T	17: 57,053,597	V248M	probably damaging	Het
Smg1	A	T	7: 118,146,071	D3008E	possibly damaging	Het
St18	A	G	1: 6,802,616	S192G	possibly damaging	Het
Supt20	T	A	3: 54,709,325	V306E	probably damaging	Het
T	T	C	17: 8,441,765	Y403H	probably damaging	Het
Tarsl2	C	A	7: 65,683,819	N588K	probably benign	Het
Tmem132c	T	C	5: 127,563,843	V1026A	probably benign	Het
Trpv4	T	C	5: 114,636,445	T193A	probably benign	Het
Ubqln4	A	G	3: 88,563,199	N326S	probably damaging	Het
Uggt2	G	A	14: 119,019,486	T1112I	probably damaging	Het
Vasn	C	T	16: 4,648,420	P77L	probably benign	Het
Vps9d1	A	C	8: 123,247,965		probably null	Het
Washc4	C	A	10: 83,579,554	Q803K	possibly damaging	Het
Zcchc2	C	T	1: 106,030,700	T967I	probably damaging	Het
Zfp874a	G	A	13: 67,442,354	L404F	possibly damaging	Het
Zscan30	T	C	18: 23,971,716		noncoding transcript	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R6297:Rnf20	UTSW	4	49642132	missense	probably damaging	1.00
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
R9599:Rnf20	UTSW	4	49638751	missense	probably benign	0.00
R9661:Rnf20	UTSW	4	49654556	missense	probably damaging	0.99
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGAATGCTTGACTCAGTCC -3'
(R):5'- AAAACACTTGCTGCTCTTGC -3'

Sequencing Primer
(F):5'- GAATGCTTGACTCAGTCCTTTTG -3'
(R):5'- TGGAAGCTCCCTGCACTCATG -3'

Posted On

2016-09-01