Incidental Mutation 'R5423:Vasn'
ID 426726
Institutional Source Beutler Lab
Gene Symbol Vasn
Ensembl Gene ENSMUSG00000039646
Gene Name vasorin
Synonyms ATIA, Slitl2, 2610528G05Rik
MMRRC Submission 042989-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock # R5423 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 4639941-4650802 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 4648420 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Leucine at position 77 (P77L)
Ref Sequence ENSEMBL: ENSMUSP00000045162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038552] [ENSMUST00000038770] [ENSMUST00000090480] [ENSMUST00000135823]
AlphaFold Q9CZT5
Predicted Effect probably benign
Transcript: ENSMUST00000038552
SMART Domains Protein: ENSMUSP00000048489
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
DUF1900 251 385 4.49e-60 SMART
low complexity region 427 456 N/A INTRINSIC
DUF1899 463 528 1.2e-19 SMART
WD40 531 570 3.64e-2 SMART
WD40 580 620 8.55e-8 SMART
WD40 623 662 1.16e-9 SMART
low complexity region 667 679 N/A INTRINSIC
DUF1900 718 854 6.69e-68 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000038770
AA Change: P77L

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000045162
Gene: ENSMUSG00000039646
AA Change: P77L

DomainStartEndE-ValueType
low complexity region 7 18 N/A INTRINSIC
LRRNT 24 57 4.05e-5 SMART
LRR_TYP 76 99 8.15e-6 SMART
LRR_TYP 100 123 6.23e-2 SMART
LRR_TYP 124 147 6.42e-4 SMART
LRR 169 192 1.99e0 SMART
low complexity region 197 206 N/A INTRINSIC
LRR 216 238 6.22e0 SMART
LRR 239 263 1.16e2 SMART
LRR 264 287 1.15e1 SMART
LRRCT 299 351 2.03e-11 SMART
EGF 409 443 2.79e-4 SMART
FN3 460 544 2.72e-3 SMART
transmembrane domain 578 600 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090480
SMART Domains Protein: ENSMUSP00000087966
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130125
Predicted Effect probably benign
Transcript: ENSMUST00000135823
SMART Domains Protein: ENSMUSP00000118310
Gene: ENSMUSG00000039637

DomainStartEndE-ValueType
DUF1899 3 64 6.41e-15 SMART
WD40 66 106 1.83e-7 SMART
WD40 115 154 4.13e0 SMART
WD40 157 196 1.78e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144815
Meta Mutation Damage Score 0.0875 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (60/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted allele exhibit increased sensitivity to TNFalpha-induced lethality, TNFalpha-, cycloheximide-, or CoCl2-induced cell death, and reduced male fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Adamts9 A G 6: 92,880,697 I289T possibly damaging Het
Ak4 T G 4: 101,460,563 I110S probably damaging Het
Arhgap9 T G 10: 127,329,549 I609S probably damaging Het
Arid4a C A 12: 71,069,860 S242* probably null Het
Ceacam1 T G 7: 25,474,526 I235L probably benign Het
Chil3 T C 3: 106,148,662 D365G probably damaging Het
Ckap2 A C 8: 22,177,196 S216R probably benign Het
Cyp2e1 G T 7: 140,770,118 V239L probably benign Het
Dnah7b T A 1: 46,358,271 M3954K probably benign Het
Ercc6l2 A T 13: 63,872,258 probably benign Het
Etv5 T C 16: 22,383,654 D468G probably damaging Het
Fbxo44 T A 4: 148,154,229 I213F probably benign Het
Gm5084 A G 13: 60,212,542 noncoding transcript Het
Gm5724 T A 6: 141,744,462 K188N probably damaging Het
Gpr17 G A 18: 31,947,641 T123I probably damaging Het
Grin3a A G 4: 49,770,376 probably benign Het
H2-D1 T G 17: 35,265,907 L248R probably damaging Het
Hmcn1 T C 1: 150,701,972 I2013V probably damaging Het
Hp1bp3 A T 4: 138,225,897 D84V probably damaging Het
Ift140 T C 17: 25,033,085 F33S probably damaging Het
Inhbc C G 10: 127,357,427 C240S probably damaging Het
Iqgap1 T A 7: 80,799,862 E62V probably damaging Het
Kcna4 G A 2: 107,295,806 W295* probably null Het
Kdm4a C T 4: 118,138,908 A975T probably damaging Het
Lrrtm3 T C 10: 64,088,152 D412G possibly damaging Het
Midn A C 10: 80,155,193 I346L probably benign Het
Ndufa10 C T 1: 92,462,320 D259N probably benign Het
Nefh C A 11: 4,940,985 A545S possibly damaging Het
Prpf8 A G 11: 75,508,958 Y2281C probably damaging Het
Psip1 G A 4: 83,460,130 probably benign Het
Ptpro G T 6: 137,442,707 A184S probably damaging Het
Rab37 T A 11: 115,157,027 I65K possibly damaging Het
Rasgrp4 T C 7: 29,145,136 L247P probably damaging Het
Rnf20 T C 4: 49,644,620 V295A probably damaging Het
Serpina3g A G 12: 104,237,994 probably benign Het
Shox2 A G 3: 66,973,754 probably benign Het
Skint6 T G 4: 112,850,740 D977A possibly damaging Het
Slc25a23 C T 17: 57,053,597 V248M probably damaging Het
Smg1 A T 7: 118,146,071 D3008E possibly damaging Het
St18 A G 1: 6,802,616 S192G possibly damaging Het
Supt20 T A 3: 54,709,325 V306E probably damaging Het
T T C 17: 8,441,765 Y403H probably damaging Het
Tarsl2 C A 7: 65,683,819 N588K probably benign Het
Tmem132c T C 5: 127,563,843 V1026A probably benign Het
Trpv4 T C 5: 114,636,445 T193A probably benign Het
Ubqln4 A G 3: 88,563,199 N326S probably damaging Het
Uggt2 G A 14: 119,019,486 T1112I probably damaging Het
Vps9d1 A C 8: 123,247,965 probably null Het
Washc4 C A 10: 83,579,554 Q803K possibly damaging Het
Zcchc2 C T 1: 106,030,700 T967I probably damaging Het
Zfp874a G A 13: 67,442,354 L404F possibly damaging Het
Zscan30 T C 18: 23,971,716 noncoding transcript Het
Other mutations in Vasn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Vasn APN 16 4648368 missense probably benign 0.00
IGL01543:Vasn APN 16 4649892 missense possibly damaging 0.60
PIT4243001:Vasn UTSW 16 4649616 missense probably damaging 1.00
PIT4810001:Vasn UTSW 16 4650045 missense probably benign
R1394:Vasn UTSW 16 4649712 nonsense probably null
R1459:Vasn UTSW 16 4648609 splice site probably null
R2136:Vasn UTSW 16 4649795 nonsense probably null
R4482:Vasn UTSW 16 4648326 missense possibly damaging 0.87
R5733:Vasn UTSW 16 4650162 missense possibly damaging 0.93
R7230:Vasn UTSW 16 4649622 missense probably benign 0.10
R7507:Vasn UTSW 16 4649481 missense probably damaging 1.00
R8261:Vasn UTSW 16 4648296 missense probably damaging 0.97
R8858:Vasn UTSW 16 4648969 missense probably benign 0.34
R9083:Vasn UTSW 16 4650007 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AGAAGATGCACTCCAGGAGC -3'
(R):5'- TTCGGTTCTTGCCCAGGTAG -3'

Sequencing Primer
(F):5'- GAGCTGCCTGCCACCTCTC -3'
(R):5'- TTCTTGCCCAGGTAGAGGCG -3'
Posted On 2016-09-01