Incidental Mutation 'R5424:Tgm7'
ID426740
Institutional Source Beutler Lab
Gene Symbol Tgm7
Ensembl Gene ENSMUSG00000079103
Gene Nametransglutaminase 7
SynonymsTGz
MMRRC Submission 042990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5424 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location121093565-121109795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121099041 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 251 (M251L)
Ref Sequence ENSEMBL: ENSMUSP00000106303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110675]
Predicted Effect probably damaging
Transcript: ENSMUST00000110675
AA Change: M251L

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106303
Gene: ENSMUSG00000079103
AA Change: M251L

DomainStartEndE-ValueType
TGc 177 270 2.54e-42 SMART
SCOP:d1kv3a2 395 512 1e-33 SMART
Pfam:Transglut_C 514 612 1.7e-20 PFAM
Meta Mutation Damage Score 0.6256 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transglutaminases (TGM; EC 2.3.2.13) are a family of structurally and functionally related enzymes that stabilize protein assemblies through the formation of gamma-glutamyl-epsilon lysine crosslinks. For additional background information on transglutaminases, see TGM1 (MIM 190195).[supplied by OMIM, Jul 2002]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,941 A300D probably damaging Het
Abca14 T C 7: 120,211,554 Y119H probably benign Het
Actb A G 5: 142,905,551 probably benign Het
Ada T A 2: 163,728,125 K323* probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Aire A T 10: 78,036,719 V355E probably damaging Het
Atp8a1 T C 5: 67,812,100 I117M probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Clca2 A G 3: 145,084,181 F465L probably damaging Het
Cpne8 T A 15: 90,516,057 M345L probably benign Het
Ddx54 T C 5: 120,619,861 probably null Het
Dnah14 T G 1: 181,763,310 M3256R possibly damaging Het
Epha2 T A 4: 141,318,940 Y483* probably null Het
Ermard T A 17: 15,059,770 S509T possibly damaging Het
Fam186a G T 15: 99,945,763 H867N unknown Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gas8 C A 8: 123,526,512 L200I possibly damaging Het
Gfra2 A T 14: 70,895,847 D39V probably damaging Het
Gm10770 T C 2: 150,179,028 T190A probably benign Het
Gm2617 T C 19: 9,323,956 noncoding transcript Het
Gm5592 C T 7: 41,155,593 probably benign Het
Gmppb T A 9: 108,052,005 probably null Het
Ifit2 T A 19: 34,574,058 C333S probably benign Het
Ighg2b T C 12: 113,307,930 K1R unknown Het
Impdh2-ps G T 8: 100,031,509 noncoding transcript Het
Kdelr2 A C 5: 143,418,144 E96A probably benign Het
Lama2 G A 10: 26,984,396 R3032C probably damaging Het
Lipg T A 18: 74,954,253 I166F probably damaging Het
Lrrc8b T C 5: 105,480,703 V305A probably damaging Het
Marveld2 T C 13: 100,612,187 H128R probably benign Het
Mgat4a A G 1: 37,466,555 V189A probably benign Het
Mroh2b A T 15: 4,941,612 E1033V probably damaging Het
Mtmr7 A G 8: 40,606,830 V80A probably benign Het
Ndrg2 A G 14: 51,908,885 S153P probably damaging Het
Nelfa C T 5: 33,921,845 probably null Het
Nes G T 3: 87,978,824 E1419D possibly damaging Het
Nipa1 C A 7: 55,979,475 V297L possibly damaging Het
Obox5 T A 7: 15,758,882 I254K probably benign Het
Olfr1058 G A 2: 86,385,840 Q193* probably null Het
Olfr689 T C 7: 105,314,571 V189A possibly damaging Het
Pcdhga7 G A 18: 37,715,335 A132T probably benign Het
Pla1a T A 16: 38,414,775 I186F probably damaging Het
Plscr4 T A 9: 92,490,022 M282K possibly damaging Het
Rpl22l1 T C 3: 28,806,898 probably benign Het
Scn5a T C 9: 119,501,734 D1246G probably damaging Het
Senp7 A G 16: 56,186,108 S932G possibly damaging Het
Slc51a C A 16: 32,478,747 A111S probably benign Het
Srcin1 T A 11: 97,537,059 K236* probably null Het
Tbxas1 A G 6: 39,027,905 D362G possibly damaging Het
Tcl1b5 T C 12: 105,180,016 I116T possibly damaging Het
Tnn T A 1: 160,122,702 Q778L possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp622 T C 15: 25,984,769 C74R probably damaging Het
Zfp646 C A 7: 127,882,703 H1351N possibly damaging Het
Other mutations in Tgm7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Tgm7 APN 2 121106915 missense probably benign 0.16
IGL01576:Tgm7 APN 2 121101033 missense probably damaging 1.00
IGL01982:Tgm7 APN 2 121093625 nonsense probably null
IGL02077:Tgm7 APN 2 121103835 missense probably damaging 1.00
IGL02135:Tgm7 APN 2 121099038 missense possibly damaging 0.75
R0063:Tgm7 UTSW 2 121094096 missense probably benign 0.01
R0412:Tgm7 UTSW 2 121101065 missense probably damaging 1.00
R1869:Tgm7 UTSW 2 121101089 missense probably damaging 1.00
R2201:Tgm7 UTSW 2 121098581 missense probably damaging 1.00
R2276:Tgm7 UTSW 2 121098564 missense probably damaging 1.00
R2279:Tgm7 UTSW 2 121098564 missense probably damaging 1.00
R2872:Tgm7 UTSW 2 121109693 start gained probably benign
R2872:Tgm7 UTSW 2 121109693 start gained probably benign
R4523:Tgm7 UTSW 2 121098588 critical splice acceptor site probably null
R4688:Tgm7 UTSW 2 121094021 missense probably benign 0.06
R4757:Tgm7 UTSW 2 121096389 missense possibly damaging 0.75
R4858:Tgm7 UTSW 2 121098964 critical splice donor site probably null
R5132:Tgm7 UTSW 2 121104219 missense probably damaging 1.00
R5141:Tgm7 UTSW 2 121100999 missense probably benign 0.05
R5911:Tgm7 UTSW 2 121095973 missense probably benign 0.27
R6166:Tgm7 UTSW 2 121099058 missense probably damaging 1.00
R6364:Tgm7 UTSW 2 121096397 nonsense probably null
R6636:Tgm7 UTSW 2 121101090 missense probably damaging 1.00
R6637:Tgm7 UTSW 2 121101090 missense probably damaging 1.00
R6950:Tgm7 UTSW 2 121093647 missense probably damaging 1.00
R7094:Tgm7 UTSW 2 121099008 missense probably damaging 1.00
R7536:Tgm7 UTSW 2 121096397 nonsense probably null
R7729:Tgm7 UTSW 2 121093710 missense probably benign
R7822:Tgm7 UTSW 2 121103940 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTGGGAAATGGCCGTACC -3'
(R):5'- CTCCTTTGCTGATGGTGACG -3'

Sequencing Primer
(F):5'- AAATGGCCGTACCCCTCTG -3'
(R):5'- GAGACAAGGTTTCTCTATGCAGTCC -3'
Posted On2016-09-01