Incidental Mutation 'R0494:Atp2a3'
ID 42675
Institutional Source Beutler Lab
Gene Symbol Atp2a3
Ensembl Gene ENSMUSG00000020788
Gene Name ATPase, Ca++ transporting, ubiquitous
Synonyms Serca3
MMRRC Submission 038691-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.137) question?
Stock # R0494 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 72851995-72883869 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 72872731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 760 (F760L)
Ref Sequence ENSEMBL: ENSMUSP00000127036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021142] [ENSMUST00000108484] [ENSMUST00000108485] [ENSMUST00000108486] [ENSMUST00000163326]
AlphaFold Q64518
Predicted Effect probably damaging
Transcript: ENSMUST00000021142
AA Change: F760L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021142
Gene: ENSMUSG00000020788
AA Change: F760L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 92 340 3.1e-66 PFAM
Pfam:Hydrolase 345 715 5.2e-22 PFAM
Pfam:HAD 348 712 3e-19 PFAM
Pfam:Cation_ATPase 418 528 4.4e-23 PFAM
Pfam:Hydrolase_3 684 747 4.5e-8 PFAM
Pfam:Cation_ATPase_C 784 987 1.8e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108484
AA Change: F742L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104124
Gene: ENSMUSG00000020788
AA Change: F742L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 3.4e-16 SMART
Pfam:E1-E2_ATPase 93 341 8.9e-67 PFAM
Pfam:Hydrolase 345 697 8.1e-27 PFAM
Pfam:HAD 348 694 4.1e-14 PFAM
Pfam:Hydrolase_like2 418 528 2.1e-21 PFAM
Pfam:Hydrolase_3 666 729 2.6e-6 PFAM
transmembrane domain 742 764 N/A INTRINSIC
Pfam:Cation_ATPase_C 766 969 4.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108485
AA Change: F760L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104125
Gene: ENSMUSG00000020788
AA Change: F760L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.1e-68 PFAM
Pfam:Hydrolase 345 715 2.7e-33 PFAM
Pfam:HAD 348 712 1.3e-17 PFAM
Pfam:Hydrolase_like2 418 528 2.2e-23 PFAM
Pfam:Hydrolase_3 684 747 1.8e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.6e-48 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108486
AA Change: F742L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104126
Gene: ENSMUSG00000020788
AA Change: F742L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 697 2.8e-28 PFAM
Pfam:HAD 348 694 1.1e-15 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 666 729 5.1e-8 PFAM
Pfam:Cation_ATPase_C 766 969 2.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135234
Predicted Effect probably damaging
Transcript: ENSMUST00000163326
AA Change: F760L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000127036
Gene: ENSMUSG00000020788
AA Change: F760L

DomainStartEndE-ValueType
Cation_ATPase_N 3 77 4.43e-12 SMART
Pfam:E1-E2_ATPase 93 341 1.4e-68 PFAM
Pfam:Hydrolase 345 715 6.5e-33 PFAM
Pfam:HAD 348 712 2.5e-17 PFAM
Pfam:Hydrolase_like2 418 528 1.7e-23 PFAM
Pfam:Hydrolase_3 684 747 5.1e-8 PFAM
Pfam:Cation_ATPase_C 784 987 2.5e-48 PFAM
Meta Mutation Damage Score 0.9439 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (109/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the SERCA Ca(2+)-ATPases, which are intracellular pumps located in the sarcoplasmic or endoplasmic reticula of muscle cells. This enzyme catalyzes the hydrolysis of ATP coupled with the translocation of calcium from the cytosol to the sarcoplasmic reticulum lumen, and is involved in calcium sequestration associated with muscular excitation and contraction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced endothelial-dependent relaxation in the aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf T C 11: 84,402,339 (GRCm39) I116V probably benign Het
Abhd18 T C 3: 40,871,123 (GRCm39) F94S probably damaging Het
Adam28 T A 14: 68,868,241 (GRCm39) probably benign Het
Afg2a G C 3: 37,486,312 (GRCm39) D345H possibly damaging Het
Amn1 A T 6: 149,086,634 (GRCm39) probably benign Het
Arhgap32 T C 9: 32,170,199 (GRCm39) V993A probably damaging Het
Arhgap33 A T 7: 30,223,921 (GRCm39) S703T probably damaging Het
Arhgef1 T C 7: 24,618,785 (GRCm39) probably benign Het
Atg2a A G 19: 6,303,407 (GRCm39) Y1083C probably damaging Het
B9d1 A G 11: 61,403,271 (GRCm39) probably benign Het
Batf C T 12: 85,733,636 (GRCm39) probably benign Het
BC051019 T A 7: 109,317,182 (GRCm39) Y170F probably benign Het
Bphl T C 13: 34,221,754 (GRCm39) *37Q probably null Het
Cab39l T C 14: 59,737,008 (GRCm39) S43P probably damaging Het
Cad A G 5: 31,234,856 (GRCm39) probably benign Het
Cct4 T G 11: 22,946,014 (GRCm39) S119A probably benign Het
Cd163 G A 6: 124,288,408 (GRCm39) V280M probably damaging Het
Cd86 A G 16: 36,438,999 (GRCm39) probably benign Het
Cdh23 G A 10: 60,152,375 (GRCm39) probably benign Het
Cdhr5 A G 7: 140,852,431 (GRCm39) F145S probably damaging Het
Cdt1 T C 8: 123,298,799 (GRCm39) S479P possibly damaging Het
Ces2g T C 8: 105,693,199 (GRCm39) V372A probably benign Het
Chrna3 T C 9: 54,929,562 (GRCm39) D92G probably damaging Het
Cndp1 A G 18: 84,637,658 (GRCm39) S359P probably benign Het
Cops4 A G 5: 100,676,528 (GRCm39) Q93R probably damaging Het
Dgka G C 10: 128,556,952 (GRCm39) probably benign Het
Dmp1 A T 5: 104,360,074 (GRCm39) D250V probably damaging Het
Dnajb2 C T 1: 75,216,278 (GRCm39) probably benign Het
Dock9 T C 14: 121,899,996 (GRCm39) T113A possibly damaging Het
Egln3 T A 12: 54,250,107 (GRCm39) I81F probably benign Het
Elapor2 G A 5: 9,470,723 (GRCm39) probably null Het
Elovl5 T C 9: 77,868,199 (GRCm39) V37A probably benign Het
Esco1 A T 18: 10,594,940 (GRCm39) N115K probably benign Het
Fat1 A T 8: 45,403,579 (GRCm39) N110I probably damaging Het
Fezf1 T A 6: 23,246,054 (GRCm39) K370N probably damaging Het
Galnt18 T A 7: 111,153,771 (GRCm39) K284N probably damaging Het
Glt8d1 C A 14: 30,733,580 (GRCm39) T355K possibly damaging Het
Gm17455 G A 10: 60,239,014 (GRCm39) R93H possibly damaging Het
Gng8 T A 7: 16,629,213 (GRCm39) D46E probably benign Het
Gpx4 T C 10: 79,892,011 (GRCm39) probably benign Het
Grk2 A T 19: 4,341,347 (GRCm39) N189K probably damaging Het
Grm5 T C 7: 87,779,989 (GRCm39) V1143A probably benign Het
Hibch A G 1: 52,942,055 (GRCm39) E237G possibly damaging Het
Hipk2 C T 6: 38,706,924 (GRCm39) A682T probably benign Het
Hmcn1 G T 1: 150,608,543 (GRCm39) probably benign Het
Htt A G 5: 34,979,188 (GRCm39) D857G possibly damaging Het
Idh2 C T 7: 79,748,005 (GRCm39) A232T probably damaging Het
Igsf8 A G 1: 172,146,265 (GRCm39) E421G probably benign Het
Kif26a T A 12: 112,145,905 (GRCm39) probably null Het
Klhl26 T C 8: 70,904,251 (GRCm39) Y519C probably damaging Het
Lamc1 A C 1: 153,122,682 (GRCm39) probably null Het
Mical3 A T 6: 120,936,162 (GRCm39) S1455T possibly damaging Het
Mitf G A 6: 97,971,390 (GRCm39) G186S probably benign Het
Ms4a15 G A 19: 10,958,722 (GRCm39) probably benign Het
Myo5b A G 18: 74,787,038 (GRCm39) E481G probably damaging Het
Nanos3 C T 8: 84,902,763 (GRCm39) R133Q probably damaging Het
Nbeal2 C A 9: 110,456,255 (GRCm39) V1686L probably damaging Het
Nedd4l T G 18: 65,306,092 (GRCm39) S335A possibly damaging Het
Nos1 A T 5: 118,043,539 (GRCm39) N605Y probably damaging Het
Nyx C A X: 13,353,508 (GRCm39) T454K probably benign Het
Or52n2 A G 7: 104,542,478 (GRCm39) L119P probably damaging Het
Or8g55 T A 9: 39,784,698 (GRCm39) N42K probably damaging Het
Pcdhb12 T A 18: 37,571,148 (GRCm39) F765I probably benign Het
Pex3 C T 10: 13,403,532 (GRCm39) G330R probably damaging Het
Pfkfb1 T C X: 149,417,609 (GRCm39) Y339H probably damaging Het
Pias1 G A 9: 62,794,593 (GRCm39) Q26* probably null Het
Pik3cg C A 12: 32,254,545 (GRCm39) V481L possibly damaging Het
Plcg2 C T 8: 118,282,843 (GRCm39) T108M probably damaging Het
Pon2 G A 6: 5,267,059 (GRCm39) probably benign Het
Ppef2 A T 5: 92,400,952 (GRCm39) probably benign Het
Pramel21 G T 4: 143,342,726 (GRCm39) V278F probably benign Het
Ptpn22 A G 3: 103,767,771 (GRCm39) K18E probably damaging Het
Pum2 C T 12: 8,771,736 (GRCm39) Q360* probably null Het
Rab10 A C 12: 3,302,723 (GRCm39) probably null Het
Ranbp2 T G 10: 58,303,254 (GRCm39) S809A possibly damaging Het
Rbms2 A G 10: 127,969,539 (GRCm39) V348A probably benign Het
Rnf213 A G 11: 119,316,838 (GRCm39) E988G possibly damaging Het
Rnf213 A T 11: 119,333,946 (GRCm39) M3052L probably damaging Het
Rpl14 C A 9: 120,403,428 (GRCm39) probably benign Het
Rplp0 A G 5: 115,697,931 (GRCm39) Y13C possibly damaging Het
Ryr1 A G 7: 28,703,218 (GRCm39) probably benign Het
Sac3d1 T C 19: 6,168,324 (GRCm39) E98G probably damaging Het
Scn10a T A 9: 119,453,166 (GRCm39) D1242V probably damaging Het
Scnn1b T C 7: 121,498,681 (GRCm39) Y74H probably damaging Het
Serpinb3a C T 1: 106,975,212 (GRCm39) W198* probably null Het
Sf3b4 C A 3: 96,081,017 (GRCm39) D108E probably damaging Het
Shprh T C 10: 11,032,935 (GRCm39) V307A probably damaging Het
Slc2a2 A G 3: 28,781,426 (GRCm39) D458G probably benign Het
Strc T C 2: 121,210,014 (GRCm39) D103G probably damaging Het
Synrg T C 11: 83,910,369 (GRCm39) I923T probably benign Het
Tango6 G T 8: 107,462,314 (GRCm39) probably benign Het
Tas2r106 A G 6: 131,655,539 (GRCm39) L104P probably damaging Het
Tat C T 8: 110,718,316 (GRCm39) P67L probably damaging Het
Tln2 A C 9: 67,262,479 (GRCm39) S593A probably benign Het
Tmem94 A G 11: 115,685,607 (GRCm39) probably null Het
Tppp3 G A 8: 106,194,804 (GRCm39) A109V probably benign Het
Trank1 T C 9: 111,220,361 (GRCm39) F2366S probably benign Het
Trpc5 T A X: 143,264,392 (GRCm39) Y155F probably damaging Het
Trpv1 A G 11: 73,151,268 (GRCm39) T451A probably benign Het
Ttc9 C A 12: 81,678,423 (GRCm39) A82E probably damaging Het
Ttll11 T A 2: 35,834,886 (GRCm39) N180I probably damaging Het
Ttn T C 2: 76,566,743 (GRCm39) N28050S possibly damaging Het
Vmn2r73 G T 7: 85,522,140 (GRCm39) H66Q probably benign Het
Vmn2r92 C T 17: 18,388,219 (GRCm39) A408V probably damaging Het
Wnt3 G A 11: 103,703,141 (GRCm39) C208Y probably damaging Het
Zfp521 C A 18: 13,978,325 (GRCm39) C696F probably damaging Het
Zfp521 T C 18: 13,979,927 (GRCm39) D162G probably damaging Het
Zfp869 A T 8: 70,159,054 (GRCm39) H506Q probably damaging Het
Other mutations in Atp2a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00834:Atp2a3 APN 11 72,873,613 (GRCm39) missense probably damaging 0.98
IGL01141:Atp2a3 APN 11 72,873,491 (GRCm39) missense probably damaging 1.00
IGL01949:Atp2a3 APN 11 72,872,723 (GRCm39) missense probably damaging 1.00
IGL02267:Atp2a3 APN 11 72,878,810 (GRCm39) missense probably damaging 1.00
IGL02385:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02390:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02391:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02392:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02487:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02525:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02526:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02527:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02581:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02643:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02644:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02646:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02647:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02649:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02650:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02651:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02667:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02668:Atp2a3 APN 11 72,866,165 (GRCm39) missense probably benign 0.00
IGL02819:Atp2a3 APN 11 72,868,033 (GRCm39) missense probably damaging 1.00
IGL02888:Atp2a3 APN 11 72,867,954 (GRCm39) splice site probably benign
Aplomb UTSW 11 72,871,274 (GRCm39) missense probably damaging 1.00
flair UTSW 11 72,866,223 (GRCm39) missense probably damaging 1.00
panache UTSW 11 72,872,765 (GRCm39) missense probably damaging 1.00
R0193:Atp2a3 UTSW 11 72,863,046 (GRCm39) missense possibly damaging 0.57
R0357:Atp2a3 UTSW 11 72,861,757 (GRCm39) critical splice donor site probably null
R0376:Atp2a3 UTSW 11 72,873,528 (GRCm39) missense probably damaging 1.00
R0452:Atp2a3 UTSW 11 72,868,058 (GRCm39) splice site probably null
R0588:Atp2a3 UTSW 11 72,863,850 (GRCm39) missense possibly damaging 0.79
R0674:Atp2a3 UTSW 11 72,872,711 (GRCm39) missense probably damaging 1.00
R1586:Atp2a3 UTSW 11 72,882,570 (GRCm39) missense probably damaging 0.98
R1666:Atp2a3 UTSW 11 72,869,633 (GRCm39) critical splice donor site probably null
R1994:Atp2a3 UTSW 11 72,866,240 (GRCm39) missense probably damaging 0.99
R2087:Atp2a3 UTSW 11 72,871,274 (GRCm39) missense probably damaging 1.00
R4675:Atp2a3 UTSW 11 72,872,623 (GRCm39) missense probably damaging 1.00
R4795:Atp2a3 UTSW 11 72,863,855 (GRCm39) missense probably benign 0.01
R4898:Atp2a3 UTSW 11 72,873,506 (GRCm39) missense probably damaging 1.00
R5083:Atp2a3 UTSW 11 72,873,652 (GRCm39) missense probably null 0.49
R5174:Atp2a3 UTSW 11 72,871,041 (GRCm39) missense probably damaging 1.00
R5266:Atp2a3 UTSW 11 72,866,223 (GRCm39) missense probably damaging 1.00
R5304:Atp2a3 UTSW 11 72,879,383 (GRCm39) missense probably damaging 0.98
R5802:Atp2a3 UTSW 11 72,863,708 (GRCm39) missense probably damaging 1.00
R6107:Atp2a3 UTSW 11 72,879,287 (GRCm39) critical splice acceptor site probably null
R6157:Atp2a3 UTSW 11 72,871,442 (GRCm39) missense probably damaging 1.00
R6760:Atp2a3 UTSW 11 72,873,566 (GRCm39) missense probably damaging 1.00
R7406:Atp2a3 UTSW 11 72,869,576 (GRCm39) missense probably damaging 1.00
R8818:Atp2a3 UTSW 11 72,872,765 (GRCm39) missense probably damaging 1.00
R9376:Atp2a3 UTSW 11 72,863,290 (GRCm39) missense probably damaging 1.00
R9456:Atp2a3 UTSW 11 72,871,131 (GRCm39) missense probably benign 0.07
R9562:Atp2a3 UTSW 11 72,873,578 (GRCm39) missense probably damaging 1.00
R9608:Atp2a3 UTSW 11 72,879,866 (GRCm39) missense probably benign 0.40
Z1176:Atp2a3 UTSW 11 72,880,366 (GRCm39) missense probably benign
Z1176:Atp2a3 UTSW 11 72,871,448 (GRCm39) missense possibly damaging 0.96
Z1177:Atp2a3 UTSW 11 72,871,153 (GRCm39) missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGATGCACCAGCCCTGAAGAAG -3'
(R):5'- ATGTAGACACCCTGTTGCCCTGTG -3'

Sequencing Primer
(F):5'- GGCAGAGATCGGCATCG -3'
(R):5'- TGGATTGTACCACAGGGGT -3'
Posted On 2013-05-23