Incidental Mutation 'R5424:Nipa1'
ID426758
Institutional Source Beutler Lab
Gene Symbol Nipa1
Ensembl Gene ENSMUSG00000047037
Gene Namenon imprinted in Prader-Willi/Angelman syndrome 1 homolog (human)
Synonyms1110027G09Rik, Spg6, A830014A18Rik
MMRRC Submission 042990-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5424 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location55977567-56019954 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 55979475 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 297 (V297L)
Ref Sequence ENSEMBL: ENSMUSP00000053871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052204]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052204
AA Change: V297L

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000053871
Gene: ENSMUSG00000047037
AA Change: V297L

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 21 308 1.6e-86 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130189
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205400
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a magnesium transporter that associates with early endosomes and the cell surface in a variety of neuronal and epithelial cells. This protein may play a role in nervous system development and maintenance. Multiple transcript variants encoding different isoforms have been found for this gene. Mutations in this gene have been associated with autosomal dominant spastic paraplegia 6. [provided by RefSeq, Nov 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,941 A300D probably damaging Het
Abca14 T C 7: 120,211,554 Y119H probably benign Het
Actb A G 5: 142,905,551 probably benign Het
Ada T A 2: 163,728,125 K323* probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Aire A T 10: 78,036,719 V355E probably damaging Het
Atp8a1 T C 5: 67,812,100 I117M probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Clca2 A G 3: 145,084,181 F465L probably damaging Het
Cpne8 T A 15: 90,516,057 M345L probably benign Het
Ddx54 T C 5: 120,619,861 probably null Het
Dnah14 T G 1: 181,763,310 M3256R possibly damaging Het
Epha2 T A 4: 141,318,940 Y483* probably null Het
Ermard T A 17: 15,059,770 S509T possibly damaging Het
Fam186a G T 15: 99,945,763 H867N unknown Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gas8 C A 8: 123,526,512 L200I possibly damaging Het
Gfra2 A T 14: 70,895,847 D39V probably damaging Het
Gm10770 T C 2: 150,179,028 T190A probably benign Het
Gm2617 T C 19: 9,323,956 noncoding transcript Het
Gm5592 C T 7: 41,155,593 probably benign Het
Gmppb T A 9: 108,052,005 probably null Het
Ifit2 T A 19: 34,574,058 C333S probably benign Het
Ighg2b T C 12: 113,307,930 K1R unknown Het
Impdh2-ps G T 8: 100,031,509 noncoding transcript Het
Kdelr2 A C 5: 143,418,144 E96A probably benign Het
Lama2 G A 10: 26,984,396 R3032C probably damaging Het
Lipg T A 18: 74,954,253 I166F probably damaging Het
Lrrc8b T C 5: 105,480,703 V305A probably damaging Het
Marveld2 T C 13: 100,612,187 H128R probably benign Het
Mgat4a A G 1: 37,466,555 V189A probably benign Het
Mroh2b A T 15: 4,941,612 E1033V probably damaging Het
Mtmr7 A G 8: 40,606,830 V80A probably benign Het
Ndrg2 A G 14: 51,908,885 S153P probably damaging Het
Nelfa C T 5: 33,921,845 probably null Het
Nes G T 3: 87,978,824 E1419D possibly damaging Het
Obox5 T A 7: 15,758,882 I254K probably benign Het
Olfr1058 G A 2: 86,385,840 Q193* probably null Het
Olfr689 T C 7: 105,314,571 V189A possibly damaging Het
Pcdhga7 G A 18: 37,715,335 A132T probably benign Het
Pla1a T A 16: 38,414,775 I186F probably damaging Het
Plscr4 T A 9: 92,490,022 M282K possibly damaging Het
Rpl22l1 T C 3: 28,806,898 probably benign Het
Scn5a T C 9: 119,501,734 D1246G probably damaging Het
Senp7 A G 16: 56,186,108 S932G possibly damaging Het
Slc51a C A 16: 32,478,747 A111S probably benign Het
Srcin1 T A 11: 97,537,059 K236* probably null Het
Tbxas1 A G 6: 39,027,905 D362G possibly damaging Het
Tcl1b5 T C 12: 105,180,016 I116T possibly damaging Het
Tgm7 T A 2: 121,099,041 M251L probably damaging Het
Tnn T A 1: 160,122,702 Q778L possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp622 T C 15: 25,984,769 C74R probably damaging Het
Zfp646 C A 7: 127,882,703 H1351N possibly damaging Het
Other mutations in Nipa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Nipa1 APN 7 55979661 missense probably benign 0.20
impressionless UTSW 7 55979606 missense probably benign 0.04
untouched UTSW 7 55979823 missense probably damaging 1.00
R2116:Nipa1 UTSW 7 55985525 missense possibly damaging 0.69
R2141:Nipa1 UTSW 7 55997511 splice site probably null
R2142:Nipa1 UTSW 7 55997511 splice site probably null
R4823:Nipa1 UTSW 7 55979688 missense possibly damaging 0.71
R5463:Nipa1 UTSW 7 55979457 nonsense probably null
R6459:Nipa1 UTSW 7 55979606 missense probably benign 0.04
R6468:Nipa1 UTSW 7 56019504 missense probably benign 0.39
R6615:Nipa1 UTSW 7 55979823 missense probably damaging 1.00
R7662:Nipa1 UTSW 7 55979624 missense probably damaging 0.98
R7921:Nipa1 UTSW 7 55979810 missense probably damaging 1.00
R7957:Nipa1 UTSW 7 55979799 missense probably damaging 1.00
R8445:Nipa1 UTSW 7 55979718 missense probably benign 0.03
X0064:Nipa1 UTSW 7 55979759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACTGGATTATTAGTTCACAGGC -3'
(R):5'- TGGGCTGCAGCATCATTGTC -3'

Sequencing Primer
(F):5'- TTAGTTCACAGGCAATGCTCAC -3'
(R):5'- GCAGCATCATTGTCCAATTCAGG -3'
Posted On2016-09-01