Incidental Mutation 'R5424:Wdr17'
ID426763
Institutional Source Beutler Lab
Gene Symbol Wdr17
Ensembl Gene ENSMUSG00000039375
Gene NameWD repeat domain 17
SynonymsB230207L18Rik, 3010002I12Rik
MMRRC Submission 042990-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5424 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location54629055-54887184 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 54681399 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 349 (G349R)
Ref Sequence ENSEMBL: ENSMUSP00000122326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000127511] [ENSMUST00000144482] [ENSMUST00000144711] [ENSMUST00000150488] [ENSMUST00000175915]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126316
Predicted Effect probably damaging
Transcript: ENSMUST00000127511
AA Change: G373R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115550
Gene: ENSMUSG00000039375
AA Change: G373R

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 162 202 1.58e2 SMART
WD40 205 252 4.26e1 SMART
WD40 255 298 1.15e0 SMART
WD40 383 422 1.59e-7 SMART
WD40 425 465 2.39e0 SMART
WD40 468 509 5.52e-2 SMART
WD40 511 550 4.14e-6 SMART
WD40 555 595 5.14e-11 SMART
WD40 598 638 6.58e-9 SMART
WD40 641 681 6.28e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144482
AA Change: G60R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134950
Gene: ENSMUSG00000039375
AA Change: G60R

DomainStartEndE-ValueType
Blast:WD40 16 65 2e-24 BLAST
WD40 70 109 1.59e-7 SMART
WD40 112 152 2.39e0 SMART
WD40 155 196 5.52e-2 SMART
WD40 198 237 4.14e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000144711
AA Change: G356R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117710
Gene: ENSMUSG00000039375
AA Change: G356R

DomainStartEndE-ValueType
WD40 72 112 8.55e-8 SMART
WD40 194 235 7.64e1 SMART
WD40 238 281 1.15e0 SMART
WD40 366 405 1.59e-7 SMART
WD40 408 448 2.39e0 SMART
WD40 451 492 5.52e-2 SMART
WD40 494 533 4.14e-6 SMART
WD40 538 578 5.14e-11 SMART
WD40 581 621 6.58e-9 SMART
WD40 624 664 6.28e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000150488
AA Change: G349R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122326
Gene: ENSMUSG00000039375
AA Change: G349R

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000175915
AA Change: G349R

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135805
Gene: ENSMUSG00000039375
AA Change: G349R

DomainStartEndE-ValueType
WD40 48 88 8.55e-8 SMART
WD40 138 178 1.58e2 SMART
WD40 181 228 4.26e1 SMART
WD40 231 274 1.15e0 SMART
WD40 359 398 1.59e-7 SMART
WD40 401 441 2.39e0 SMART
WD40 444 485 5.52e-2 SMART
WD40 487 526 4.14e-6 SMART
WD40 531 571 5.14e-11 SMART
WD40 574 614 6.58e-9 SMART
WD40 617 657 6.28e-6 SMART
Meta Mutation Damage Score 0.3416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein. It is abundantly expressed in retina and testis, and is thought to be a candidate gene for retinal disease. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,941 A300D probably damaging Het
Abca14 T C 7: 120,211,554 Y119H probably benign Het
Actb A G 5: 142,905,551 probably benign Het
Ada T A 2: 163,728,125 K323* probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Aire A T 10: 78,036,719 V355E probably damaging Het
Atp8a1 T C 5: 67,812,100 I117M probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Clca2 A G 3: 145,084,181 F465L probably damaging Het
Cpne8 T A 15: 90,516,057 M345L probably benign Het
Ddx54 T C 5: 120,619,861 probably null Het
Dnah14 T G 1: 181,763,310 M3256R possibly damaging Het
Epha2 T A 4: 141,318,940 Y483* probably null Het
Ermard T A 17: 15,059,770 S509T possibly damaging Het
Fam186a G T 15: 99,945,763 H867N unknown Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gas8 C A 8: 123,526,512 L200I possibly damaging Het
Gfra2 A T 14: 70,895,847 D39V probably damaging Het
Gm10770 T C 2: 150,179,028 T190A probably benign Het
Gm2617 T C 19: 9,323,956 noncoding transcript Het
Gm5592 C T 7: 41,155,593 probably benign Het
Gmppb T A 9: 108,052,005 probably null Het
Ifit2 T A 19: 34,574,058 C333S probably benign Het
Ighg2b T C 12: 113,307,930 K1R unknown Het
Impdh2-ps G T 8: 100,031,509 noncoding transcript Het
Kdelr2 A C 5: 143,418,144 E96A probably benign Het
Lama2 G A 10: 26,984,396 R3032C probably damaging Het
Lipg T A 18: 74,954,253 I166F probably damaging Het
Lrrc8b T C 5: 105,480,703 V305A probably damaging Het
Marveld2 T C 13: 100,612,187 H128R probably benign Het
Mgat4a A G 1: 37,466,555 V189A probably benign Het
Mroh2b A T 15: 4,941,612 E1033V probably damaging Het
Mtmr7 A G 8: 40,606,830 V80A probably benign Het
Ndrg2 A G 14: 51,908,885 S153P probably damaging Het
Nelfa C T 5: 33,921,845 probably null Het
Nes G T 3: 87,978,824 E1419D possibly damaging Het
Nipa1 C A 7: 55,979,475 V297L possibly damaging Het
Obox5 T A 7: 15,758,882 I254K probably benign Het
Olfr1058 G A 2: 86,385,840 Q193* probably null Het
Olfr689 T C 7: 105,314,571 V189A possibly damaging Het
Pcdhga7 G A 18: 37,715,335 A132T probably benign Het
Pla1a T A 16: 38,414,775 I186F probably damaging Het
Plscr4 T A 9: 92,490,022 M282K possibly damaging Het
Rpl22l1 T C 3: 28,806,898 probably benign Het
Scn5a T C 9: 119,501,734 D1246G probably damaging Het
Senp7 A G 16: 56,186,108 S932G possibly damaging Het
Slc51a C A 16: 32,478,747 A111S probably benign Het
Srcin1 T A 11: 97,537,059 K236* probably null Het
Tbxas1 A G 6: 39,027,905 D362G possibly damaging Het
Tcl1b5 T C 12: 105,180,016 I116T possibly damaging Het
Tgm7 T A 2: 121,099,041 M251L probably damaging Het
Tnn T A 1: 160,122,702 Q778L possibly damaging Het
Zfp622 T C 15: 25,984,769 C74R probably damaging Het
Zfp646 C A 7: 127,882,703 H1351N possibly damaging Het
Other mutations in Wdr17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Wdr17 APN 8 54687711 missense probably damaging 1.00
IGL00496:Wdr17 APN 8 54659579 splice site probably benign
IGL01318:Wdr17 APN 8 54672550 missense probably damaging 1.00
IGL01347:Wdr17 APN 8 54651345 missense probably benign
IGL01654:Wdr17 APN 8 54662879 missense probably damaging 1.00
IGL02010:Wdr17 APN 8 54659703 missense probably damaging 0.97
IGL02085:Wdr17 APN 8 54687736 nonsense probably null
IGL02205:Wdr17 APN 8 54696300 missense probably damaging 1.00
IGL02375:Wdr17 APN 8 54696388 missense possibly damaging 0.94
IGL02705:Wdr17 APN 8 54648215 splice site probably null
IGL02719:Wdr17 APN 8 54693054 splice site probably null
IGL03051:Wdr17 APN 8 54651314 missense probably damaging 0.99
IGL03131:Wdr17 APN 8 54696267 critical splice donor site probably null
IGL03172:Wdr17 APN 8 54661480 missense probably damaging 0.96
enthralled UTSW 8 54659681 missense possibly damaging 0.85
riveted UTSW 8 54632487 missense probably benign 0.00
thrilled UTSW 8 54696268 critical splice donor site probably null
IGL03138:Wdr17 UTSW 8 54649143 missense probably damaging 1.00
PIT4458001:Wdr17 UTSW 8 54673579 nonsense probably null
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0011:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R0124:Wdr17 UTSW 8 54635491 missense probably damaging 1.00
R0226:Wdr17 UTSW 8 54663008 missense probably benign 0.08
R0270:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0271:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0288:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0321:Wdr17 UTSW 8 54696268 critical splice donor site probably null
R0464:Wdr17 UTSW 8 54670392 splice site probably benign
R0479:Wdr17 UTSW 8 54651421 intron probably null
R0488:Wdr17 UTSW 8 54693052 unclassified probably benign
R0552:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0553:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0600:Wdr17 UTSW 8 54661495 missense probably damaging 1.00
R0621:Wdr17 UTSW 8 54643191 missense probably benign 0.18
R0655:Wdr17 UTSW 8 54649198 missense probably damaging 1.00
R0730:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
R0789:Wdr17 UTSW 8 54659572 splice site probably benign
R0854:Wdr17 UTSW 8 54703881 missense probably benign
R0879:Wdr17 UTSW 8 54661481 missense probably benign 0.08
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1462:Wdr17 UTSW 8 54670328 missense probably damaging 1.00
R1497:Wdr17 UTSW 8 54672501 missense possibly damaging 0.87
R1589:Wdr17 UTSW 8 54703907 intron probably benign
R1618:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R1768:Wdr17 UTSW 8 54673654 missense possibly damaging 0.84
R1778:Wdr17 UTSW 8 54690214 missense probably damaging 1.00
R1819:Wdr17 UTSW 8 54690124 missense probably benign 0.18
R1913:Wdr17 UTSW 8 54687726 missense probably damaging 1.00
R2129:Wdr17 UTSW 8 54632381 missense probably damaging 1.00
R2132:Wdr17 UTSW 8 54672506 missense probably damaging 1.00
R2309:Wdr17 UTSW 8 54643248 missense probably benign
R3882:Wdr17 UTSW 8 54639501 missense possibly damaging 0.53
R4097:Wdr17 UTSW 8 54635469 missense probably damaging 1.00
R4372:Wdr17 UTSW 8 54639895 missense probably damaging 1.00
R4380:Wdr17 UTSW 8 54648407 intron probably benign
R4480:Wdr17 UTSW 8 54664964 critical splice donor site probably null
R4654:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4656:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R4669:Wdr17 UTSW 8 54690048 missense possibly damaging 0.72
R4719:Wdr17 UTSW 8 54639876 missense probably benign 0.33
R4912:Wdr17 UTSW 8 54629861 missense probably damaging 1.00
R5000:Wdr17 UTSW 8 54665126 missense possibly damaging 0.82
R5073:Wdr17 UTSW 8 54690236 critical splice acceptor site probably null
R5176:Wdr17 UTSW 8 54653878 critical splice donor site probably null
R5194:Wdr17 UTSW 8 54687604 missense probably damaging 1.00
R5270:Wdr17 UTSW 8 54643186 missense probably benign 0.20
R5300:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5325:Wdr17 UTSW 8 54659681 missense possibly damaging 0.85
R5336:Wdr17 UTSW 8 54632318 missense probably damaging 1.00
R5394:Wdr17 UTSW 8 54639489 missense possibly damaging 0.73
R5425:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5426:Wdr17 UTSW 8 54681399 missense probably damaging 1.00
R5548:Wdr17 UTSW 8 54703851 missense probably damaging 0.97
R5681:Wdr17 UTSW 8 54662869 missense probably damaging 1.00
R5722:Wdr17 UTSW 8 54660771 critical splice donor site probably null
R5894:Wdr17 UTSW 8 54696300 missense probably damaging 1.00
R5906:Wdr17 UTSW 8 54639468 missense probably benign 0.33
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6038:Wdr17 UTSW 8 54632311 critical splice donor site probably null
R6391:Wdr17 UTSW 8 54661460 missense probably benign 0.04
R6605:Wdr17 UTSW 8 54681524 missense probably benign 0.16
R6892:Wdr17 UTSW 8 54673596 missense probably damaging 1.00
R7019:Wdr17 UTSW 8 54681453 missense probably damaging 1.00
R7257:Wdr17 UTSW 8 54632487 missense probably benign 0.00
R7481:Wdr17 UTSW 8 54661336 missense probably benign
V5088:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
V5622:Wdr17 UTSW 8 54693096 missense possibly damaging 0.85
X0022:Wdr17 UTSW 8 54639494 missense probably benign 0.04
X0066:Wdr17 UTSW 8 54673560 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGGGCTACCTAGTTGAGTTACTTAG -3'
(R):5'- TGCCTAATTTTCAGCCACATTG -3'

Sequencing Primer
(F):5'- ACCTAGTTGAGTTACTTAGATGAGC -3'
(R):5'- ACACTGAGTTTTATGCTCATTTTTGG -3'
Posted On2016-09-01