Incidental Mutation 'R5424:Aire'
ID426770
Institutional Source Beutler Lab
Gene Symbol Aire
Ensembl Gene ENSMUSG00000000731
Gene Nameautoimmune regulator (autoimmune polyendocrinopathy candidiasis ectodermal dystrophy)
Synonyms
MMRRC Submission 042990-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5424 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location78030022-78043610 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78036719 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 355 (V355E)
Ref Sequence ENSEMBL: ENSMUSP00000101035 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019257] [ENSMUST00000105395] [ENSMUST00000105396] [ENSMUST00000128241] [ENSMUST00000130972] [ENSMUST00000131028] [ENSMUST00000140636] [ENSMUST00000143735] [ENSMUST00000145975] [ENSMUST00000148469] [ENSMUST00000154374] [ENSMUST00000155021] [ENSMUST00000156417]
Predicted Effect probably damaging
Transcript: ENSMUST00000019257
AA Change: V355E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019257
Gene: ENSMUSG00000000731
AA Change: V355E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 8.9e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
low complexity region 398 419 N/A INTRINSIC
PHD 432 475 7.82e-7 SMART
RING 433 474 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105395
AA Change: V356E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101034
Gene: ENSMUSG00000000731
AA Change: V356E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105396
AA Change: V355E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101035
Gene: ENSMUSG00000000731
AA Change: V355E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
RING 300 341 3.63e0 SMART
PHD 373 416 7.82e-7 SMART
RING 374 415 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128241
AA Change: V356E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000114904
Gene: ENSMUSG00000000731
AA Change: V356E

DomainStartEndE-ValueType
Pfam:Sp100 5 104 3.3e-27 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
low complexity region 399 420 N/A INTRINSIC
PHD 433 476 7.82e-7 SMART
RING 434 475 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130972
AA Change: V351E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122659
Gene: ENSMUSG00000000731
AA Change: V351E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
low complexity region 394 415 N/A INTRINSIC
PHD 428 471 7.82e-7 SMART
RING 429 470 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131028
SMART Domains Protein: ENSMUSP00000114808
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 5 57 2.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140636
AA Change: V351E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000121477
Gene: ENSMUSG00000000731
AA Change: V351E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141255
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143452
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143548
Predicted Effect probably benign
Transcript: ENSMUST00000143735
SMART Domains Protein: ENSMUSP00000123678
Gene: ENSMUSG00000000731

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.1e-34 PFAM
SAND 198 264 2.61e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145975
AA Change: V352E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120150
Gene: ENSMUSG00000000731
AA Change: V352E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
RING 297 338 3.63e0 SMART
low complexity region 395 416 N/A INTRINSIC
PHD 429 472 7.82e-7 SMART
RING 430 471 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148469
AA Change: V352E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000118317
Gene: ENSMUSG00000000731
AA Change: V352E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 296 339 6.75e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154374
AA Change: V356E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117094
Gene: ENSMUSG00000000731
AA Change: V356E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 7.4e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 300 343 6.75e-11 SMART
RING 301 342 3.63e0 SMART
PHD 374 417 7.82e-7 SMART
RING 375 416 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155021
AA Change: V351E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122190
Gene: ENSMUSG00000000731
AA Change: V351E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 2.2e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 295 338 6.75e-11 SMART
RING 296 337 3.63e0 SMART
PHD 369 412 7.82e-7 SMART
RING 370 411 2.49e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156417
AA Change: V355E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115162
Gene: ENSMUSG00000000731
AA Change: V355E

DomainStartEndE-ValueType
Pfam:Sp100 1 107 1.6e-34 PFAM
SAND 198 264 2.61e-26 SMART
PHD 299 342 6.75e-11 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transcriptional regulator that forms nuclear bodies and interacts with the transcriptional coactivator CREB binding protein. The encoded protein plays an important role in immunity by regulating the expression of autoantigens and negative selection of autoreactive T-cells in the thymus. Mutations in this gene cause the rare autosomal-recessive systemic autoimmune disease termed autoimmune polyendocrinopathy with candidiasis and ectodermal dystrophy (APECED). [provided by RefSeq, Jun 2012]
PHENOTYPE: Targeted mutations that inactivate the gene result in immune system dysfunction characterized by multiorgan lymphocytic infiltration and circulating autoantibodies. Whereas one line is fertile, another exhibits male and female sterility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,941 A300D probably damaging Het
Abca14 T C 7: 120,211,554 Y119H probably benign Het
Actb A G 5: 142,905,551 probably benign Het
Ada T A 2: 163,728,125 K323* probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Atp8a1 T C 5: 67,812,100 I117M probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Clca2 A G 3: 145,084,181 F465L probably damaging Het
Cpne8 T A 15: 90,516,057 M345L probably benign Het
Ddx54 T C 5: 120,619,861 probably null Het
Dnah14 T G 1: 181,763,310 M3256R possibly damaging Het
Epha2 T A 4: 141,318,940 Y483* probably null Het
Ermard T A 17: 15,059,770 S509T possibly damaging Het
Fam186a G T 15: 99,945,763 H867N unknown Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gas8 C A 8: 123,526,512 L200I possibly damaging Het
Gfra2 A T 14: 70,895,847 D39V probably damaging Het
Gm10770 T C 2: 150,179,028 T190A probably benign Het
Gm2617 T C 19: 9,323,956 noncoding transcript Het
Gm5592 C T 7: 41,155,593 probably benign Het
Gmppb T A 9: 108,052,005 probably null Het
Ifit2 T A 19: 34,574,058 C333S probably benign Het
Ighg2b T C 12: 113,307,930 K1R unknown Het
Impdh2-ps G T 8: 100,031,509 noncoding transcript Het
Kdelr2 A C 5: 143,418,144 E96A probably benign Het
Lama2 G A 10: 26,984,396 R3032C probably damaging Het
Lipg T A 18: 74,954,253 I166F probably damaging Het
Lrrc8b T C 5: 105,480,703 V305A probably damaging Het
Marveld2 T C 13: 100,612,187 H128R probably benign Het
Mgat4a A G 1: 37,466,555 V189A probably benign Het
Mroh2b A T 15: 4,941,612 E1033V probably damaging Het
Mtmr7 A G 8: 40,606,830 V80A probably benign Het
Ndrg2 A G 14: 51,908,885 S153P probably damaging Het
Nelfa C T 5: 33,921,845 probably null Het
Nes G T 3: 87,978,824 E1419D possibly damaging Het
Nipa1 C A 7: 55,979,475 V297L possibly damaging Het
Obox5 T A 7: 15,758,882 I254K probably benign Het
Olfr1058 G A 2: 86,385,840 Q193* probably null Het
Olfr689 T C 7: 105,314,571 V189A possibly damaging Het
Pcdhga7 G A 18: 37,715,335 A132T probably benign Het
Pla1a T A 16: 38,414,775 I186F probably damaging Het
Plscr4 T A 9: 92,490,022 M282K possibly damaging Het
Rpl22l1 T C 3: 28,806,898 probably benign Het
Scn5a T C 9: 119,501,734 D1246G probably damaging Het
Senp7 A G 16: 56,186,108 S932G possibly damaging Het
Slc51a C A 16: 32,478,747 A111S probably benign Het
Srcin1 T A 11: 97,537,059 K236* probably null Het
Tbxas1 A G 6: 39,027,905 D362G possibly damaging Het
Tcl1b5 T C 12: 105,180,016 I116T possibly damaging Het
Tgm7 T A 2: 121,099,041 M251L probably damaging Het
Tnn T A 1: 160,122,702 Q778L possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp622 T C 15: 25,984,769 C74R probably damaging Het
Zfp646 C A 7: 127,882,703 H1351N possibly damaging Het
Other mutations in Aire
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01744:Aire APN 10 78036723 nonsense probably null
IGL01969:Aire APN 10 78042982 missense probably damaging 1.00
BB008:Aire UTSW 10 78030296 missense probably damaging 1.00
BB018:Aire UTSW 10 78030296 missense probably damaging 1.00
E0370:Aire UTSW 10 78042063 missense probably damaging 1.00
IGL03055:Aire UTSW 10 78043069 missense probably damaging 1.00
R0326:Aire UTSW 10 78042599 missense probably damaging 1.00
R0675:Aire UTSW 10 78034493 splice site probably benign
R1748:Aire UTSW 10 78043480 missense probably damaging 0.99
R1754:Aire UTSW 10 78030290 missense probably damaging 1.00
R2014:Aire UTSW 10 78042958 missense probably damaging 1.00
R2015:Aire UTSW 10 78042958 missense probably damaging 1.00
R3800:Aire UTSW 10 78042055 splice site probably null
R5517:Aire UTSW 10 78039691 missense probably benign 0.14
R5983:Aire UTSW 10 78043069 missense probably damaging 1.00
R6135:Aire UTSW 10 78042967 missense probably damaging 1.00
R6856:Aire UTSW 10 78030255 missense probably damaging 1.00
R7405:Aire UTSW 10 78034613 missense probably benign 0.01
R7484:Aire UTSW 10 78042570 missense probably damaging 1.00
R7606:Aire UTSW 10 78037933 missense probably damaging 1.00
R7931:Aire UTSW 10 78030296 missense probably damaging 1.00
R8867:Aire UTSW 10 78037975 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGCTTTTGGAGAATATTGGC -3'
(R):5'- TGACACAGAGGGTCCTCAAG -3'

Sequencing Primer
(F):5'- GGAAGCTGTTTTTAATCCCTTGGCC -3'
(R):5'- AAGCCATCCTTGCCATACATTTGG -3'
Posted On2016-09-01