Incidental Mutation 'R5424:Ifit2'
ID426789
Institutional Source Beutler Lab
Gene Symbol Ifit2
Ensembl Gene ENSMUSG00000045932
Gene Nameinterferon-induced protein with tetratricopeptide repeats 2
SynonymsIfi54
MMRRC Submission 042990-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R5424 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location34550694-34576419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34574058 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 333 (C333S)
Ref Sequence ENSEMBL: ENSMUSP00000099890 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102826] [ENSMUST00000149829]
Predicted Effect probably benign
Transcript: ENSMUST00000102826
AA Change: C333S

PolyPhen 2 Score 0.195 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000099890
Gene: ENSMUSG00000045932
AA Change: C333S

DomainStartEndE-ValueType
Pfam:TPR_2 95 127 4e-4 PFAM
Pfam:TPR_8 95 127 3.8e-4 PFAM
Blast:TPR 138 171 7e-11 BLAST
Blast:TPR 172 208 2e-9 BLAST
low complexity region 211 222 N/A INTRINSIC
Pfam:TPR_19 225 286 4e-8 PFAM
low complexity region 396 406 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149829
Meta Mutation Damage Score 0.2782 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (59/59)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased susuceptibility to VSV infection with increased lethality and brain viral titer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AA986860 C A 1: 130,742,941 A300D probably damaging Het
Abca14 T C 7: 120,211,554 Y119H probably benign Het
Actb A G 5: 142,905,551 probably benign Het
Ada T A 2: 163,728,125 K323* probably null Het
Adam22 C A 5: 8,090,182 G202W probably damaging Het
Aire A T 10: 78,036,719 V355E probably damaging Het
Atp8a1 T C 5: 67,812,100 I117M probably damaging Het
Cdc45 C T 16: 18,795,897 R205H probably damaging Het
Clca2 A G 3: 145,084,181 F465L probably damaging Het
Cpne8 T A 15: 90,516,057 M345L probably benign Het
Ddx54 T C 5: 120,619,861 probably null Het
Dnah14 T G 1: 181,763,310 M3256R possibly damaging Het
Epha2 T A 4: 141,318,940 Y483* probably null Het
Ermard T A 17: 15,059,770 S509T possibly damaging Het
Fam186a G T 15: 99,945,763 H867N unknown Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gas8 C A 8: 123,526,512 L200I possibly damaging Het
Gfra2 A T 14: 70,895,847 D39V probably damaging Het
Gm10770 T C 2: 150,179,028 T190A probably benign Het
Gm2617 T C 19: 9,323,956 noncoding transcript Het
Gm5592 C T 7: 41,155,593 probably benign Het
Gmppb T A 9: 108,052,005 probably null Het
Ighg2b T C 12: 113,307,930 K1R unknown Het
Impdh2-ps G T 8: 100,031,509 noncoding transcript Het
Kdelr2 A C 5: 143,418,144 E96A probably benign Het
Lama2 G A 10: 26,984,396 R3032C probably damaging Het
Lipg T A 18: 74,954,253 I166F probably damaging Het
Lrrc8b T C 5: 105,480,703 V305A probably damaging Het
Marveld2 T C 13: 100,612,187 H128R probably benign Het
Mgat4a A G 1: 37,466,555 V189A probably benign Het
Mroh2b A T 15: 4,941,612 E1033V probably damaging Het
Mtmr7 A G 8: 40,606,830 V80A probably benign Het
Ndrg2 A G 14: 51,908,885 S153P probably damaging Het
Nelfa C T 5: 33,921,845 probably null Het
Nes G T 3: 87,978,824 E1419D possibly damaging Het
Nipa1 C A 7: 55,979,475 V297L possibly damaging Het
Obox5 T A 7: 15,758,882 I254K probably benign Het
Olfr1058 G A 2: 86,385,840 Q193* probably null Het
Olfr689 T C 7: 105,314,571 V189A possibly damaging Het
Pcdhga7 G A 18: 37,715,335 A132T probably benign Het
Pla1a T A 16: 38,414,775 I186F probably damaging Het
Plscr4 T A 9: 92,490,022 M282K possibly damaging Het
Rpl22l1 T C 3: 28,806,898 probably benign Het
Scn5a T C 9: 119,501,734 D1246G probably damaging Het
Senp7 A G 16: 56,186,108 S932G possibly damaging Het
Slc51a C A 16: 32,478,747 A111S probably benign Het
Srcin1 T A 11: 97,537,059 K236* probably null Het
Tbxas1 A G 6: 39,027,905 D362G possibly damaging Het
Tcl1b5 T C 12: 105,180,016 I116T possibly damaging Het
Tgm7 T A 2: 121,099,041 M251L probably damaging Het
Tnn T A 1: 160,122,702 Q778L possibly damaging Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Zfp622 T C 15: 25,984,769 C74R probably damaging Het
Zfp646 C A 7: 127,882,703 H1351N possibly damaging Het
Other mutations in Ifit2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01099:Ifit2 APN 19 34573302 missense probably damaging 1.00
IGL02261:Ifit2 APN 19 34574224 missense probably damaging 1.00
IGL02375:Ifit2 APN 19 34574337 missense probably benign 0.01
Pushup UTSW 19 34574045 missense probably benign 0.38
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0017:Ifit2 UTSW 19 34573573 missense probably damaging 1.00
R0682:Ifit2 UTSW 19 34573612 missense probably benign 0.13
R0927:Ifit2 UTSW 19 34573584 missense probably benign 0.03
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1462:Ifit2 UTSW 19 34573186 missense probably null 0.12
R1526:Ifit2 UTSW 19 34573202 missense probably benign 0.00
R2084:Ifit2 UTSW 19 34573350 missense probably damaging 1.00
R3971:Ifit2 UTSW 19 34574041 missense probably benign 0.00
R4008:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4010:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4011:Ifit2 UTSW 19 34574045 missense probably benign 0.38
R4359:Ifit2 UTSW 19 34573144 missense possibly damaging 0.85
R5179:Ifit2 UTSW 19 34573576 missense probably damaging 1.00
R5240:Ifit2 UTSW 19 34574396 missense probably benign 0.02
R5528:Ifit2 UTSW 19 34573537 missense possibly damaging 0.63
R6605:Ifit2 UTSW 19 34573497 nonsense probably null
R7172:Ifit2 UTSW 19 34573494 missense probably benign 0.24
R7424:Ifit2 UTSW 19 34573198 missense probably benign 0.37
R8090:Ifit2 UTSW 19 34573262 missense possibly damaging 0.70
X0023:Ifit2 UTSW 19 34574250 missense possibly damaging 0.59
X0064:Ifit2 UTSW 19 34573923 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GCAGCCAGGTTTTATTGCAAG -3'
(R):5'- AGATAGCCTTGTCTTGACGC -3'

Sequencing Primer
(F):5'- CAGACAGAGCTATACAGTTGCTTAG -3'
(R):5'- ATAGCCTTGTCTTGACGCTTCATTTG -3'
Posted On2016-09-01