Incidental Mutation 'R5425:Csf1'
ID426803
Institutional Source Beutler Lab
Gene Symbol Csf1
Ensembl Gene ENSMUSG00000014599
Gene Namecolony stimulating factor 1 (macrophage)
Synonymscolony-stimulating factor-1, CSF-1, Csfm, M-CSF
MMRRC Submission 042991-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.720) question?
Stock #R5425 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107741048-107760469 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107748896 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 273 (L273P)
Ref Sequence ENSEMBL: ENSMUSP00000113617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014743] [ENSMUST00000118593] [ENSMUST00000120243] [ENSMUST00000120654] [ENSMUST00000153114] [ENSMUST00000156820]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014743
AA Change: L273P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000014743
Gene: ENSMUSG00000014599
AA Change: L273P

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118593
SMART Domains Protein: ENSMUSP00000113136
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 1 257 9.5e-123 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120243
AA Change: L273P

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113617
Gene: ENSMUSG00000014599
AA Change: L273P

DomainStartEndE-ValueType
Pfam:CSF-1 1 254 6.8e-91 PFAM
Pfam:CSF-1 272 552 1.1e-147 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120654
SMART Domains Protein: ENSMUSP00000112832
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 31 163 1.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153114
SMART Domains Protein: ENSMUSP00000115480
Gene: ENSMUSG00000014599

DomainStartEndE-ValueType
Pfam:CSF-1 26 182 1.1e-54 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155557
Predicted Effect probably benign
Transcript: ENSMUST00000156820
AA Change: L161P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119553
Gene: ENSMUSG00000014599
AA Change: L161P

DomainStartEndE-ValueType
Pfam:CSF-1 15 142 6e-37 PFAM
Pfam:CSF-1 160 279 4.9e-52 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine that controls the production, differentiation, and function of macrophages. The active form of the protein is found extracellularly as a disulfide-linked homodimer, and is thought to be produced by proteolytic cleavage of membrane-bound precursors. The encoded protein may be involved in development of the placenta. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit lack of incisors, a broad domed skull, short thick limb bones with reduced marrow cavities, impaired hearing and vision, and reduced fertility in females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,537,692 S62G probably damaging Het
Ace A G 11: 105,973,428 E465G probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aida T A 1: 183,322,346 C174S possibly damaging Het
Aldh1a2 G A 9: 71,253,004 R104H probably benign Het
Aldh3a1 T C 11: 61,213,581 L98P probably benign Het
Ankmy1 G T 1: 92,870,957 Y20* probably null Het
Arhgap9 C A 10: 127,326,418 N314K probably damaging Het
Atxn7l1 T C 12: 33,367,120 Y427H probably damaging Het
Bola3 G T 6: 83,349,552 G18W probably benign Het
Carmil3 A G 14: 55,493,877 T138A probably benign Het
Ccnd2 A G 6: 127,150,617 Y53H probably benign Het
Cd101 T A 3: 101,018,686 D239V probably damaging Het
Ces1g T A 8: 93,325,800 Q287L probably benign Het
Cfap43 C T 19: 47,896,932 A415T possibly damaging Het
Cfap74 A G 4: 155,455,692 probably benign Het
Crnn A G 3: 93,149,149 K414R probably benign Het
Dab2ip T G 2: 35,709,991 H206Q probably benign Het
Diras2 A G 13: 52,508,047 S75P probably damaging Het
Dst T C 1: 34,179,750 V1757A probably benign Het
Dus4l A T 12: 31,640,808 H281Q probably damaging Het
Faah A T 4: 116,000,796 M436K probably null Het
Fat1 T C 8: 45,025,885 V2656A possibly damaging Het
Ffar1 A C 7: 30,860,779 L231R probably damaging Het
Gab1 T C 8: 80,800,389 K27E probably damaging Het
Gatsl3 T A 11: 4,221,689 H304Q probably damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm8909 A C 17: 36,168,485 L8R probably damaging Het
Irx6 T C 8: 92,677,517 probably null Het
Mcrs1 C A 15: 99,243,688 R376L probably damaging Het
Mrgprb1 T A 7: 48,447,971 L64F possibly damaging Het
Nck2 T G 1: 43,554,392 V253G probably benign Het
Paip1 C T 13: 119,430,166 T12M possibly damaging Het
Pdpk1 A T 17: 24,098,121 L256Q probably damaging Het
Perm1 A G 4: 156,218,295 D432G probably benign Het
Psg25 A T 7: 18,524,784 Y322* probably null Het
Pzp G A 6: 128,489,048 A1223V probably damaging Het
Rassf8 A T 6: 145,815,542 Y198F probably benign Het
Repin1 A G 6: 48,596,431 Q42R probably benign Het
Sirpb1b A C 3: 15,548,669 C51G probably damaging Het
Snx13 C T 12: 35,100,644 Q316* probably null Het
Spesp1 A G 9: 62,282,049 V5A possibly damaging Het
Sprr2e G A 3: 92,353,063 C67Y unknown Het
Tcaf3 G A 6: 42,596,763 P172S probably damaging Het
Tmem126b A G 7: 90,470,947 I72T probably benign Het
Tmem17 G T 11: 22,518,624 V188L probably benign Het
Tnfrsf1b T C 4: 145,229,108 probably null Het
Tshz2 A T 2: 169,884,024 Q180L probably damaging Het
Ttc41 A T 10: 86,776,630 I1256F probably damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ywhag G T 5: 135,911,265 H158Q probably benign Het
Other mutations in Csf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00582:Csf1 APN 3 107756727 missense probably benign 0.00
IGL00907:Csf1 APN 3 107750346 missense probably damaging 1.00
IGL01644:Csf1 APN 3 107753842 missense possibly damaging 0.84
R0022:Csf1 UTSW 3 107753862 missense probably damaging 0.99
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0025:Csf1 UTSW 3 107748644 missense probably benign
R0350:Csf1 UTSW 3 107748606 missense probably benign 0.01
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1392:Csf1 UTSW 3 107756630 missense probably benign 0.03
R1531:Csf1 UTSW 3 107748338 missense possibly damaging 0.72
R1897:Csf1 UTSW 3 107748279 missense probably damaging 1.00
R4373:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4375:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4376:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4377:Csf1 UTSW 3 107756739 missense probably damaging 1.00
R4469:Csf1 UTSW 3 107750681 critical splice donor site probably null
R4474:Csf1 UTSW 3 107753856 missense probably damaging 0.98
R4604:Csf1 UTSW 3 107756962 intron probably null
R4634:Csf1 UTSW 3 107749167 missense probably damaging 0.96
R5086:Csf1 UTSW 3 107748710 missense possibly damaging 0.72
R5156:Csf1 UTSW 3 107748936 missense probably benign 0.01
R6120:Csf1 UTSW 3 107753854 missense probably damaging 0.96
R6268:Csf1 UTSW 3 107747157 missense possibly damaging 0.86
R6269:Csf1 UTSW 3 107749001 missense probably benign 0.04
R6273:Csf1 UTSW 3 107749163 missense probably damaging 1.00
R6298:Csf1 UTSW 3 107748359 missense possibly damaging 0.96
R7196:Csf1 UTSW 3 107753898 missense possibly damaging 0.91
R7375:Csf1 UTSW 3 107748179 missense possibly damaging 0.96
R7437:Csf1 UTSW 3 107750756 missense probably benign 0.00
R7464:Csf1 UTSW 3 107748875 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTCAGTCTCTGCCTGGATG -3'
(R):5'- TAAAGCCACCCCTAGCAGTG -3'

Sequencing Primer
(F):5'- TGGATGCTGCCCCCTACAG -3'
(R):5'- ACCCCTAGCAGTGACCCG -3'
Posted On2016-09-01