Incidental Mutation 'R5425:Tcaf3'
ID 426809
Institutional Source Beutler Lab
Gene Symbol Tcaf3
Ensembl Gene ENSMUSG00000018656
Gene Name TRPM8 channel-associated factor 3
Synonyms Eapa2, Fam115e
MMRRC Submission 042991-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.050) question?
Stock # R5425 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 42564147-42574306 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 42573697 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 172 (P172S)
Ref Sequence ENSEMBL: ENSMUSP00000123321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069023] [ENSMUST00000134707]
AlphaFold Q6QR59
Predicted Effect probably damaging
Transcript: ENSMUST00000069023
AA Change: P172S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064060
Gene: ENSMUSG00000018656
AA Change: P172S

DomainStartEndE-ValueType
internal_repeat_1 26 194 9.98e-16 PROSPERO
low complexity region 210 221 N/A INTRINSIC
internal_repeat_1 234 402 9.98e-16 PROSPERO
low complexity region 509 518 N/A INTRINSIC
M60-like 533 832 3.49e-130 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000134707
AA Change: P172S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000123321
Gene: ENSMUSG00000018656
AA Change: P172S

DomainStartEndE-ValueType
low complexity region 210 221 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A G 11: 105,864,254 (GRCm39) E465G probably damaging Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Aida T A 1: 183,103,201 (GRCm39) C174S possibly damaging Het
Aldh1a2 G A 9: 71,160,286 (GRCm39) R104H probably benign Het
Aldh3a1 T C 11: 61,104,407 (GRCm39) L98P probably benign Het
Ankmy1 G T 1: 92,798,679 (GRCm39) Y20* probably null Het
Arhgap9 C A 10: 127,162,287 (GRCm39) N314K probably damaging Het
Atxn7l1 T C 12: 33,417,119 (GRCm39) Y427H probably damaging Het
Bltp3a G A 17: 28,106,489 (GRCm39) S1005N probably benign Het
Bola3 G T 6: 83,326,534 (GRCm39) G18W probably benign Het
Carmil3 A G 14: 55,731,334 (GRCm39) T138A probably benign Het
Castor1 T A 11: 4,171,689 (GRCm39) H304Q probably damaging Het
Ccnd2 A G 6: 127,127,580 (GRCm39) Y53H probably benign Het
Cd101 T A 3: 100,926,002 (GRCm39) D239V probably damaging Het
Ces1g T A 8: 94,052,428 (GRCm39) Q287L probably benign Het
Cfap43 C T 19: 47,885,371 (GRCm39) A415T possibly damaging Het
Cfap74 A G 4: 155,540,149 (GRCm39) probably benign Het
Crnn A G 3: 93,056,456 (GRCm39) K414R probably benign Het
Csf1 A G 3: 107,656,212 (GRCm39) L273P possibly damaging Het
Dab2ip T G 2: 35,600,003 (GRCm39) H206Q probably benign Het
Dipk2a T C 9: 94,419,745 (GRCm39) S62G probably damaging Het
Diras2 A G 13: 52,662,083 (GRCm39) S75P probably damaging Het
Dst T C 1: 34,218,831 (GRCm39) V1757A probably benign Het
Dus4l A T 12: 31,690,807 (GRCm39) H281Q probably damaging Het
Faah A T 4: 115,857,993 (GRCm39) M436K probably null Het
Fat1 T C 8: 45,478,922 (GRCm39) V2656A possibly damaging Het
Ffar1 A C 7: 30,560,204 (GRCm39) L231R probably damaging Het
Gab1 T C 8: 81,527,018 (GRCm39) K27E probably damaging Het
Gm14403 AAACCCTA AA 2: 177,201,448 (GRCm39) probably benign Het
H2-T5 A C 17: 36,479,377 (GRCm39) L8R probably damaging Het
Irx6 T C 8: 93,404,145 (GRCm39) probably null Het
Mcrs1 C A 15: 99,141,569 (GRCm39) R376L probably damaging Het
Mrgprb1 T A 7: 48,097,719 (GRCm39) L64F possibly damaging Het
Nck2 T G 1: 43,593,552 (GRCm39) V253G probably benign Het
Paip1 C T 13: 119,566,702 (GRCm39) T12M possibly damaging Het
Pdpk1 A T 17: 24,317,095 (GRCm39) L256Q probably damaging Het
Perm1 A G 4: 156,302,752 (GRCm39) D432G probably benign Het
Psg25 A T 7: 18,258,709 (GRCm39) Y322* probably null Het
Pzp G A 6: 128,466,011 (GRCm39) A1223V probably damaging Het
Rassf8 A T 6: 145,761,268 (GRCm39) Y198F probably benign Het
Repin1 A G 6: 48,573,365 (GRCm39) Q42R probably benign Het
Sirpb1b A C 3: 15,613,729 (GRCm39) C51G probably damaging Het
Snx13 C T 12: 35,150,643 (GRCm39) Q316* probably null Het
Spesp1 A G 9: 62,189,331 (GRCm39) V5A possibly damaging Het
Sprr2e G A 3: 92,260,370 (GRCm39) C67Y unknown Het
Tmem126b A G 7: 90,120,155 (GRCm39) I72T probably benign Het
Tmem17 G T 11: 22,468,624 (GRCm39) V188L probably benign Het
Tnfrsf1b T C 4: 144,955,678 (GRCm39) probably null Het
Tshz2 A T 2: 169,725,944 (GRCm39) Q180L probably damaging Het
Ttc41 A T 10: 86,612,494 (GRCm39) I1256F probably damaging Het
Wdr17 C T 8: 55,134,434 (GRCm39) G349R probably damaging Het
Ywhag G T 5: 135,940,119 (GRCm39) H158Q probably benign Het
Other mutations in Tcaf3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Tcaf3 APN 6 42,570,319 (GRCm39) missense probably benign 0.14
IGL00931:Tcaf3 APN 6 42,574,162 (GRCm39) missense probably benign 0.16
IGL01391:Tcaf3 APN 6 42,570,615 (GRCm39) missense probably damaging 1.00
IGL01804:Tcaf3 APN 6 42,574,063 (GRCm39) missense probably damaging 1.00
IGL02272:Tcaf3 APN 6 42,573,594 (GRCm39) missense probably damaging 0.98
IGL02934:Tcaf3 APN 6 42,570,832 (GRCm39) missense probably benign 0.00
IGL03258:Tcaf3 APN 6 42,566,773 (GRCm39) missense probably damaging 1.00
defused UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R0116:Tcaf3 UTSW 6 42,568,284 (GRCm39) missense probably benign 0.12
R0135:Tcaf3 UTSW 6 42,566,692 (GRCm39) missense probably benign
R0357:Tcaf3 UTSW 6 42,566,761 (GRCm39) missense probably damaging 0.98
R0526:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R0592:Tcaf3 UTSW 6 42,573,777 (GRCm39) missense probably benign 0.16
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1185:Tcaf3 UTSW 6 42,568,368 (GRCm39) missense probably damaging 1.00
R1902:Tcaf3 UTSW 6 42,570,486 (GRCm39) missense possibly damaging 0.83
R1912:Tcaf3 UTSW 6 42,573,622 (GRCm39) missense possibly damaging 0.59
R2020:Tcaf3 UTSW 6 42,570,658 (GRCm39) missense possibly damaging 0.66
R2238:Tcaf3 UTSW 6 42,570,262 (GRCm39) missense probably benign 0.00
R2259:Tcaf3 UTSW 6 42,568,364 (GRCm39) missense possibly damaging 0.53
R2436:Tcaf3 UTSW 6 42,570,663 (GRCm39) missense probably damaging 1.00
R3005:Tcaf3 UTSW 6 42,570,978 (GRCm39) missense probably damaging 1.00
R3402:Tcaf3 UTSW 6 42,570,787 (GRCm39) missense probably benign 0.08
R3753:Tcaf3 UTSW 6 42,566,738 (GRCm39) missense probably damaging 1.00
R3799:Tcaf3 UTSW 6 42,574,014 (GRCm39) missense probably damaging 1.00
R4515:Tcaf3 UTSW 6 42,566,930 (GRCm39) missense probably damaging 1.00
R4640:Tcaf3 UTSW 6 42,564,513 (GRCm39) missense probably damaging 0.96
R4688:Tcaf3 UTSW 6 42,570,300 (GRCm39) splice site probably null
R4904:Tcaf3 UTSW 6 42,570,931 (GRCm39) nonsense probably null
R5030:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5031:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5045:Tcaf3 UTSW 6 42,570,618 (GRCm39) missense possibly damaging 0.55
R5105:Tcaf3 UTSW 6 42,568,259 (GRCm39) missense probably damaging 1.00
R5139:Tcaf3 UTSW 6 42,573,867 (GRCm39) missense probably benign 0.03
R5187:Tcaf3 UTSW 6 42,573,954 (GRCm39) missense possibly damaging 0.51
R5196:Tcaf3 UTSW 6 42,570,649 (GRCm39) missense probably benign 0.00
R5213:Tcaf3 UTSW 6 42,568,401 (GRCm39) missense probably damaging 1.00
R5296:Tcaf3 UTSW 6 42,564,444 (GRCm39) missense possibly damaging 0.55
R5402:Tcaf3 UTSW 6 42,568,860 (GRCm39) missense probably benign 0.12
R5431:Tcaf3 UTSW 6 42,574,119 (GRCm39) missense probably damaging 1.00
R5601:Tcaf3 UTSW 6 42,564,462 (GRCm39) missense possibly damaging 0.90
R5839:Tcaf3 UTSW 6 42,570,783 (GRCm39) missense possibly damaging 0.55
R5865:Tcaf3 UTSW 6 42,573,631 (GRCm39) missense probably benign 0.07
R6005:Tcaf3 UTSW 6 42,566,905 (GRCm39) missense probably benign 0.19
R6270:Tcaf3 UTSW 6 42,570,725 (GRCm39) missense probably benign 0.00
R6341:Tcaf3 UTSW 6 42,574,193 (GRCm39) missense possibly damaging 0.55
R6344:Tcaf3 UTSW 6 42,574,105 (GRCm39) missense possibly damaging 0.48
R6521:Tcaf3 UTSW 6 42,570,172 (GRCm39) missense probably damaging 0.99
R6589:Tcaf3 UTSW 6 42,570,995 (GRCm39) missense possibly damaging 0.55
R6981:Tcaf3 UTSW 6 42,574,059 (GRCm39) missense probably damaging 1.00
R7155:Tcaf3 UTSW 6 42,570,825 (GRCm39) missense probably benign
R7185:Tcaf3 UTSW 6 42,570,864 (GRCm39) missense probably benign 0.01
R7262:Tcaf3 UTSW 6 42,570,735 (GRCm39) missense probably damaging 0.97
R7340:Tcaf3 UTSW 6 42,566,848 (GRCm39) missense probably benign 0.08
R7421:Tcaf3 UTSW 6 42,573,776 (GRCm39) missense probably benign 0.02
R7690:Tcaf3 UTSW 6 42,574,069 (GRCm39) missense probably damaging 1.00
R7850:Tcaf3 UTSW 6 42,571,140 (GRCm39) splice site probably null
R7909:Tcaf3 UTSW 6 42,568,898 (GRCm39) missense possibly damaging 0.92
R9419:Tcaf3 UTSW 6 42,573,716 (GRCm39) missense probably benign 0.00
R9440:Tcaf3 UTSW 6 42,573,906 (GRCm39) nonsense probably null
R9469:Tcaf3 UTSW 6 42,573,828 (GRCm39) missense probably benign 0.00
R9668:Tcaf3 UTSW 6 42,566,636 (GRCm39) missense probably damaging 1.00
R9787:Tcaf3 UTSW 6 42,574,024 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATAACCAGGTTATCCATGTTAGGC -3'
(R):5'- TGGGATAAATGCCTTGGTTCAGC -3'

Sequencing Primer
(F):5'- ATCCATGTTAGGCTGAAATCTCC -3'
(R):5'- ATAAATGCCTTGGTTCAGCCTGAG -3'
Posted On 2016-09-01