Incidental Mutation 'R5425:Ffar1'
ID426815
Institutional Source Beutler Lab
Gene Symbol Ffar1
Ensembl Gene ENSMUSG00000044453
Gene Namefree fatty acid receptor 1
SynonymsGpr40
MMRRC Submission 042991-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5425 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location30857390-30861564 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 30860779 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 231 (L231R)
Ref Sequence ENSEMBL: ENSMUSP00000055564 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019248] [ENSMUST00000052700] [ENSMUST00000094583] [ENSMUST00000185748]
Predicted Effect probably benign
Transcript: ENSMUST00000019248
SMART Domains Protein: ENSMUSP00000019248
Gene: ENSMUSG00000030577

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
IG 31 147 2.75e-1 SMART
IG_like 156 254 4.07e1 SMART
IGc2 269 337 2.68e-4 SMART
IGc2 365 424 4.52e-11 SMART
IG 448 523 1.21e-2 SMART
IGc2 541 599 6.75e-10 SMART
IGc2 628 687 2.68e-4 SMART
transmembrane domain 709 726 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000052700
AA Change: L231R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055564
Gene: ENSMUSG00000044453
AA Change: L231R

DomainStartEndE-ValueType
Pfam:7tm_1 22 275 1.3e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000094583
SMART Domains Protein: ENSMUSP00000092163
Gene: ENSMUSG00000019429

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:7tm_1 27 272 2.9e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000185748
SMART Domains Protein: ENSMUSP00000140252
Gene: ENSMUSG00000019429

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
Pfam:7tm_1 27 272 9.1e-39 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the GP40 family of G protein-coupled receptors that are clustered together on chromosome 19. The encoded protein is a receptor for medium and long chain free fatty acids and may be involved in the metabolic regulation of insulin secretion. Polymorphisms in this gene may be associated with type 2 diabetes. [provided by RefSeq, Apr 2009]
PHENOTYPE: There are conflicting reports on the metabolic affects of disrupting this gene. Glucose metabolism lipid levels have been studied. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik T C 9: 94,537,692 S62G probably damaging Het
Ace A G 11: 105,973,428 E465G probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
Aida T A 1: 183,322,346 C174S possibly damaging Het
Aldh1a2 G A 9: 71,253,004 R104H probably benign Het
Aldh3a1 T C 11: 61,213,581 L98P probably benign Het
Ankmy1 G T 1: 92,870,957 Y20* probably null Het
Arhgap9 C A 10: 127,326,418 N314K probably damaging Het
Atxn7l1 T C 12: 33,367,120 Y427H probably damaging Het
Bola3 G T 6: 83,349,552 G18W probably benign Het
Carmil3 A G 14: 55,493,877 T138A probably benign Het
Ccnd2 A G 6: 127,150,617 Y53H probably benign Het
Cd101 T A 3: 101,018,686 D239V probably damaging Het
Ces1g T A 8: 93,325,800 Q287L probably benign Het
Cfap43 C T 19: 47,896,932 A415T possibly damaging Het
Cfap74 A G 4: 155,455,692 probably benign Het
Crnn A G 3: 93,149,149 K414R probably benign Het
Csf1 A G 3: 107,748,896 L273P possibly damaging Het
Dab2ip T G 2: 35,709,991 H206Q probably benign Het
Diras2 A G 13: 52,508,047 S75P probably damaging Het
Dst T C 1: 34,179,750 V1757A probably benign Het
Dus4l A T 12: 31,640,808 H281Q probably damaging Het
Faah A T 4: 116,000,796 M436K probably null Het
Fat1 T C 8: 45,025,885 V2656A possibly damaging Het
Gab1 T C 8: 80,800,389 K27E probably damaging Het
Gatsl3 T A 11: 4,221,689 H304Q probably damaging Het
Gm14403 AAACCCTA AA 2: 177,509,655 probably benign Het
Gm8909 A C 17: 36,168,485 L8R probably damaging Het
Irx6 T C 8: 92,677,517 probably null Het
Mcrs1 C A 15: 99,243,688 R376L probably damaging Het
Mrgprb1 T A 7: 48,447,971 L64F possibly damaging Het
Nck2 T G 1: 43,554,392 V253G probably benign Het
Paip1 C T 13: 119,430,166 T12M possibly damaging Het
Pdpk1 A T 17: 24,098,121 L256Q probably damaging Het
Perm1 A G 4: 156,218,295 D432G probably benign Het
Psg25 A T 7: 18,524,784 Y322* probably null Het
Pzp G A 6: 128,489,048 A1223V probably damaging Het
Rassf8 A T 6: 145,815,542 Y198F probably benign Het
Repin1 A G 6: 48,596,431 Q42R probably benign Het
Sirpb1b A C 3: 15,548,669 C51G probably damaging Het
Snx13 C T 12: 35,100,644 Q316* probably null Het
Spesp1 A G 9: 62,282,049 V5A possibly damaging Het
Sprr2e G A 3: 92,353,063 C67Y unknown Het
Tcaf3 G A 6: 42,596,763 P172S probably damaging Het
Tmem126b A G 7: 90,470,947 I72T probably benign Het
Tmem17 G T 11: 22,518,624 V188L probably benign Het
Tnfrsf1b T C 4: 145,229,108 probably null Het
Tshz2 A T 2: 169,884,024 Q180L probably damaging Het
Ttc41 A T 10: 86,776,630 I1256F probably damaging Het
Uhrf1bp1 G A 17: 27,887,515 S1005N probably benign Het
Wdr17 C T 8: 54,681,399 G349R probably damaging Het
Ywhag G T 5: 135,911,265 H158Q probably benign Het
Other mutations in Ffar1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0410:Ffar1 UTSW 7 30860630 missense probably benign
R4369:Ffar1 UTSW 7 30860608 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACATATTGTTCCCCGTCCAGG -3'
(R):5'- TTCCCTGGGCATCAACATAC -3'

Sequencing Primer
(F):5'- GACCTGTTCCCAAGTAGCCAGTG -3'
(R):5'- TGGGCATCAACATACCCGTG -3'
Posted On2016-09-01